Book: Эпоха открытий



Эпоха открытий

Йен Голдин, Крис Кутарна

Эпоха открытий

Возможности и угрозы второго Ренессанса

Ian Goldin, Chris Kutarna

AGE OF DISCOVERY

Navigating the Risks and Rewards of Our New Renaissance


Перевод опубликован с согласия издательства Bloomsbury Publishing Plc


© Ian Goldin, Chris Kutarna, 2016

© Степанова В., перевод на русский язык, 2017

© Издание на русском языке, оформление. ООО «Издательская Группа «Азбука-Аттикус», 2017

КоЛибри®

* * *

Увлекательное путешествие… Эта книга поможет миру.

Ричард Брэнсон, основатель Virgin Group

Исчерпывающее руководство – и превосходное путешествие – по нашей бурной современности.

Арианна Хаффингтон, основатель, президент и главный редактор Huffington Post

Это должен прочесть каждый.

Майкл Спенс, лауреат Нобелевской премии по экономике

Живописная панорама… Мощные параллели… Ценнейшие сведения для будущих Микеланджело и Леонардо.

Рид Хоффман, основатель и президент LinkedIn

Йен и Крис поднимают ключевые актуальные вопросы – и отвечают на них… Мы должны поблагодарить их за смелость.

Кристин Лагард, глава Международного валютного фонда, экс-министр экономики и финансов Франции

Замечательный труд, увлекательный исторический обзор с элементами пророчества. Йен и Крис вручили нам по-настоящему редкий дар: саморефлексию.

Ларри Бриллиант, бывший исполнительный директор Google.org

Толика перспективы, крайне необходимая в нашем близоруком мире.

Доминик Бартон, управляющий директор McKinsey&Co

Призыв к действию, который нужно услышать всем нам.

Куми Найду, международный исполнительный директор Greenpeace International

Приятно отличается от поверхностного анализа и стерильных универсальных решений правых и левых… впечатляющая и важная книга.

Эдмунд Фелпс, лауреат Нобелевской премии по экономике

Чрезвычайно стимулирующая книга… На призыв авторов должен откликнуться каждый.

Ниалл Фергюсон, профессор истории Гарвардского университета, старший научный сотрудник Института Гувера

Познавательная и просто отличная книга.

Энтони Грейлинг, философ, глава Нового гуманитарного колледжа в Лондоне

Замечательные озарения ждут всех, кто интересуется вызовами современного мира и тем, как с ними справлялись в другие эпохи.

Эндрю Гамильтон, глава Нью-Йоркского университета, экс-ректор Оксфордского университета

Крайне важное напоминание о необходимости вылавливать возможности из массы проблем, с которыми мы сегодня сталкиваемся.

Ханс-Пол Бюркнер, председатель Boston Consulting Group

Обязательное чтение для нынешних и будущих лидеров во всем мире.

Аша Канвар, президент Commonwealth of Learning, Ванкувер

Очень своевременная книга… заинтересует всех, кто заботится о будущем человечества.

Лорд Мартин Риз, Королевский астроном Великобритании, экс-президент Королевского научного общества

Оливии и Алексу

во имя их процветания в Новом Ренессансе.

Йен Голдин

Моему отцу – самому ренессансному человеку, которого я знаю.

Крис Кутарна

Введение

Прозябать или процветать?

Момент, в который мы живем

Если бы Микеланджело родился сегодня, в нынешнее суматошное время, прозябал бы он в безвестности или так же преуспевал?

Каждый год миллионы людей приходят в Сикстинскую капеллу, чтобы благоговейно взглянуть на «Сотворение Адама» Микеланджело Буонарроти. Еще миллионы преклоняются перед «Моной Лизой» Леонардо да Винчи. На протяжении пяти веков мы бережно храним эти шедевры эпохи Ренессанса и дорожим ими как прекрасными и вдохновляющими произведениями искусства.

Но вместе с тем они бросают нам вызов.

Художники, пятьсот лет назад создавшие эти гениальные произведения, жили не в каком-то сказочном мире, где повсюду царила красота, – нет, они жили в бурную эпоху, отмеченную не только знаковыми историческими событиями и великими открытиями, но и тяжелейшими потрясениями. Их мир стал намного сложнее, чем был когда-либо, благодаря недавно изобретенному Гутенбергом печатному станку (1450-е гг.), открытию Нового Света Колумбом (1492) и морского пути к сокровищам Азии Васко да Гамой (1497). Судьбы человечества менялись, порой радикально. «Черная смерть» отступила, население Европы восстанавливалось, здоровье, благосостояние и образованность общества росли.

Гений расцветал в этих условиях, о чем свидетельствуют художественные достижения той эпохи (особенно с 1490-х до 1520-х гг.), появление гелиоцентрической теории Коперника (1510-е гг.) и революционные открытия в самых разных областях науки, от биологии до инженерного дела, от навигации до медицины. Простые и очевидные истины, которые никто не подвергал сомнению веками, даже тысячелетиями, разрушались на глазах. Земля не была неподвижной. Солнце не вращалось вокруг нее. «Известный» мир не составлял и половины целого. Человеческое сердце было не вместилищем души, а простым насосом. Благодаря книгопечатанию число новых книг в считаные десятилетия увеличилось с сотен до миллионов, а невероятные открытия и новые идеи распространялись как никогда широко и стремительно.

Но вместе с тем расцветали и опасности. Наводящие ужас новые болезни распространялись как лесной пожар по обе стороны отныне соединенной Атлантики. Османская империя, получив в свое распоряжение «новое» оружие, порох, утвердила господство ислама в Восточном Средиземноморье, одержав на суше и на море ряд ошеломляющих побед, зловещая тень которых нависла над всей Европой. Мартин Лютер (1483–1546), воспользовавшись новыми возможностями книгопечатания, во всеуслышание распространял страстные проклятия в адрес католической церкви, разжигая религиозные волнения по всему континенту. Церковь, более тысячи лет успешно державшая свои позиции и ставшая одной из самых важных и всепроникающих сил в европейской жизни, безвозвратно раскололась под этим давлением.

Такой была жизнь, когда 8 сентября 1504 г. в Италии, на главной городской площади Флоренции, Микеланджело сорвал покрывало со статуи Давида. Высотой пять метров, весом более шести тонн, высеченный из лучшего каррарского мрамора, «Давид» недвусмысленно свидетельствовал о богатстве города и о мастерстве скульптора.


Эпоха открытий

Момент, запечатленный в мраморе

Микеланджело Буонарроти. Давид (1501–1504, фрагмент). Флоренция. Фото: Art Resource


Ветхозаветную историю Давида и Голиафа знал каждый – ничем не примечательный храбрый молодой воин невероятным образом победил в поединке гигантского противника. Но Микеланджело с помощью резца и молотка запечатлел в камне момент, которого раньше никто не видел. Вероятно, это привело в некоторое замешательство тех, кто присутствовал на открытии. Лицо и шея Давида были напряжены, лоб нахмурен, а глаза пристально вглядывались в какую-то дальнюю точку. Он не стоял, торжествуя, над трупом поверженного врага (как его обычно изображали) – он готовился к битве с непоколебимой решимостью человека, который знает, каким будет его следующий шаг, но не знает, к чему он приведет. И тогда зрители ясно увидели, что имел в виду художник: Микеланджело изобразил Давида в судьбоносный момент между решением и действием, в тот момент, когда он осознал, что должен сделать, и собирался для этого с силами.

Они узнали этот момент. Они сами в нем находились.

Прошлое как пролог

Мы тоже в нем находимся.

Наше время – это противостояние между благотворными и разрушительными последствиями глобализации и развития человечества, между центробежными и центростремительными силами, между расцветом гения и бесчисленными опасностями. Что ждет каждого из нас – процветание или прозябание, и каким XXI в. войдет в учебники – как одна из лучших или худших эпох в истории человечества – зависит от наших действий, от того, сможем ли мы воспользоваться возможностями и избежать опасностей, которые несет с собой это противостояние.

На кон поставлено очень многое. Каждому из нас выпала непростая судьба родиться в этот исторический момент – решающий момент, – когда события нашей жизни и сделанный нами выбор определят обстоятельства многих и многих жизней после нас.

Да, каждое поколение тщеславно думает о себе то же самое, но на этот раз это правда. Долгосрочные факты говорят громче, чем наше эго. Переселение человечества в города, начатое около 10 тысяч лет назад нашими неолитическими предками, в наши дни пересекло половинную отметку [1]. Мы – первые поколения урбанистической эпохи. Загрязнение атмосферы сегодня привело к концентрации парниковых газов, невиданной со времен неолита; из пятнадцати самых жарких лет, зарегистрированных в наших климатических сводках, четырнадцать пришлись на XXI в. [2]. Впервые в истории число нуждающихся в мире резко сократилось (более чем на миллиард человек с 1990 г.), а общее число населения в то же время выросло (примерно на 2 миллиарда). Живущие сегодня ученые превосходят числом всех ученых, когда-либо живших до 1980 г., и (отчасти благодаря им) средняя продолжительность жизни за последние полвека увеличилась больше, чем за предыдущее тысячелетие.

В краткосрочной перспективе на наших глазах также творится история. Интернет, которого двадцать лет назад просто не существовало, соединил 1 миллиард человек в 2005 г., 2 миллиарда в 2010 г. и 3 миллиарда в 2015 г. Сейчас доступ к интернету имеет половина человечества [3]. Китай вырвался из автаркии и стал развитой экономической державой и крупнейшим в мире экспортером. От него почти не отстает Индия. Берлинская стена пала, и противостояние экономических идеологий, определившее вторую половину XX в., исчезло вместе с ней. Но все это кажется уже неактуальным по сравнению с заголовками начала нового тысячелетия: трагедия 11 сентября 2001 г., опустошительные цунами и ураганы, мировой финансовый кризис, парализовавший самые высокооплачиваемые умы мира, ядерная катастрофа в гипербезопасной Японии, террористы-смертники в сердце города любви – Парижа, протесты против разных видов неравенства… Однако есть и более приятные новости: бурное развитие мобильных и социальных сетей, расшифровка генома человека, появление 3D-печати, слом устоявшихся табу, таких как запрет на однополые браки, обнаружение гравитационных волн и открытие похожих на Землю планет на орбитах соседних звезд.

Каждый день мы просыпаемся и испытываем новый шок. И шок сам по себе является наиболее убедительным доказательством того, что эта эпоха отличается от остальных, потому что это информация, приходящая изнутри. Шок – это наше личное подтверждение исторических перемен, сверхъестественное столкновение ожиданий и реальности, шок – непреходящая тема наших жизней. Он будоражит и воодушевляет нас. И это далеко не конец. Сейчас мы не слишком много говорим об инженерной геологии, органической энергии, сверхразумных машинах, биотехнологических эпидемиях, нанофабриках искусственных человеческих хромосом, но, возможно, совсем скоро – сюрприз! – мы только об этом и будем говорить.


Мы нуждаемся – и остро нуждаемся – в перспективе

Мы не знаем, куда направляемся, поэтому позволяем скоротечным кризисам и тревогам швырять нас, порой довольно грубо, из стороны в сторону. Мы скорее отступаем, чем тянемся вперед. В эпоху, когда мы должны действовать, мы сомневаемся. В целом таковы общие настроения в сегодняшнем мире. Граждане США, некогда главные в мире поборники свободной торговли, теперь все активнее выступают против нее [4]. Промышленность по всему миру аккумулирует или распределяет рекордные объемы наличных денег, вместо того чтобы инвестировать их. По подсчетам, на конец 2015 г. мировым корпорациям принадлежало более 15 триллионов в наличных и эквивалентах денежных средств – в четыре раза больше, чем десять лет назад [5]. Компании, входящие в список S&P 500, вернули почти всю свою прибыль за 2014 г. держателям акций (через дивиденды и выкуп акций обществом), вместо того чтобы сделать ставку на новые проекты и идеи [6]. В области политики в большинстве развитых стран бурный рост популярности переживают как крайне правые течения (стремящиеся изменить отношение общества к геям, иммигрантам и международным обязательствам), так и крайне левые (стремящиеся изменить отношение общества к торговле и частным предприятиям). В 1990-е гг. повсюду звучало слово «глобализация». Многие воспринимали его как синоним общности, как отражение великих надежд на то, что мир станет лучше для каждого из нас. Сегодня это понятие вышло из моды (оставшись на устах лишь у политиков, использующих его как удобное оправдание проблем, которые они не могут решить).

Чего нам не хватает, и весьма остро не хватает, – это перспективы. Обретя ее, мы сможем увидеть противостояние, определяющее облик нашего времени, и более эффективно воздействовать на крупные силы, влияющие на наш мир. Столкнувшись с очередным потрясением, мы сможем отступить на шаг и рассмотреть его в более широком контексте, тем самым получая больше возможностей контролировать его суть (и нашу реакцию). Общественным и политическим деятелям нужна перспектива, чтобы создавать привлекательные концепции, позволяющие вносить масштабные перемены в нашу повседневную жизнь. Деловым людям нужна перспектива, чтобы прорываться сквозь информационный хаос круглосуточных новостей и принимать эффективные решения. Молодежи нужна перспектива, чтобы отыскать ответы на свои важные горящие вопросы и найти свое призвание. Перспектива – это то, что дает нам возможность превратить свою жизнь в великое путешествие. Это то, что повысит наши шансы совместно сделать XXI в. одним из лучших в истории человечества.


Эпоха открытий

Количество поисковых запросов в Google по теме «глобализация» в течение десяти лет сокращалось

Google Trends (2015). “Interest over Time: Globalization”. По данным www.google.com/trends


«Перспектива есть проводник и врата, без нее ничто не может быть сделано хорошо» [7]. Леонардо да Винчи (1452–1519) написал эти слова в качестве наставления художникам, но с тем же успехом он мог бы обратить свой совет ко всем своим современникам. Леонардо жил в тот же момент судьбоносного противостояния, который запечатлел в мраморе его современник и коллега Микеланджело (1475–1564). Чтобы увидеть в перспективе нынешнюю эпоху, нам нужно лишь сделать шаг назад, заглянуть в прошлое и осознать: все это с нами уже было. Силы, которые сошлись в Европе пятьсот лет назад, чтобы раздуть искру гения и перевернуть общественное устройство, снова присутствуют в нашей жизни. Только сейчас они мощнее и глобальнее.

Это и есть главная мысль нашей книги. Мы должны проникнуться надеждой и решимостью. Надеждой – потому что Ренессанс оставил наследие, которое мы и сейчас, пятьсот лет спустя, воспеваем как одно из самых ярких достижений человечества. Мы можем, если захотим, войти в собственный золотой век. Для этого у нас есть все необходимое. Мы можем воспользоваться этим моментом и воплотить в реальность новый расцвет, который широтой географического размаха и позитивными последствиями для человеческого благосостояния далеко превзойдет прежний Ренессанс – или любой другой век процветания в истории. Решимостью — потому что этот новый золотой век не наступит сам по себе – мы должны будем его достигнуть.

И работа не будет легкой. В 1517 г. Никколо Макиавелли (1469–1527), один из главных философов своего времени и основоположник современной политической науки, писал:

Умные люди не случайно и не без основания имеют привычку говорить: чтобы знать, что должно случиться, достаточно проследить, что было, ибо все, что происходит в мире, всегда связано с событиями прошлого. Причина состоит в том, что все человеческие дела совершаются людьми, которых вели и всегда будут вести одни и те же страсти, и поэтому они неизбежно должны приводить к одинаковым результатам [8].

Итак, мы предупреждены. Предыдущий Ренессанс был временем огромных потрясений, которые стали серьезным испытанием на прочность для человеческого общества. Сейчас мы снова рискуем упустить возможности как индивидуумы, как общество и как биологический вид – и нас уже постигло несколько крупных неудач. Это сделало многих из нас циничными и заставило бояться будущего. Если мы хотим достичь величия, на которое человечество снова имеет право, мы должны продолжать верить в то, что величие возможно. Мы должны сделать все возможное, чтобы претворить его в жизнь. Мы должны развиваться и щедро делиться преимуществами прогресса. И мы должны помогать друг другу справляться с потрясениями, которых никто из нас не способен предвидеть.

Путь вперед

Мы переосмысливаем нынешнее время как Новый Ренессанс в четырех частях.

В части I мы представляем масштабные, неопровержимые факты нашего времени и опровергаем бессвязную и часто легкомысленную риторику, пронизывающую сегодняшние публичные обсуждения. Мы отступаем на шаг назад и наглядно демонстрируем те соединяющие и развивающие силы, которые определили наступление Ренессанса пятьсот лет назад и которые за последние четверть века полностью преобразовали мир, в котором мы живем. Первооткрывательские плавания Колумба и падение Берлинской стены – оба этих события отметили слом стародавних барьеров, избавление от невежества и мифов, появление новых, охватывающих всю планету систем политического и экономического обмена. Печатный станок Гутенберга и интернет изменили человеческое общение и установили новую норму: изобилие информации, ее дешевое распространение, огромное разнообразие тем и участников общения.



Развивающие силы – достижения в области здоровья, богатства и образования – легли в основу человеческого прогресса тогда и двигают нас вперед сейчас. Войны и болезни, два главных тормоза на пути прогресса в истории человечества, отступили в предшествующие Ренессансу десятилетия. На сегодняшний день общее число потерь на поле боя также резко сократилось, даже принимая во внимание потери, связанные с гражданской войной в Сирии, а успешные кампании по борьбе с болезнями и старостью добавили почти два десятилетия к общей продолжительности жизни [9]. Кроме того, чтение, письмо и арифметика превратились из роскоши, доступной только знати, в драгоценное всеобщее достояние. Грядущее поколение взрослых станет первым в истории почти целиком грамотным поколением.

Революционные достижения в области технологии, демографии, здравоохранения и экономики придают движущую силу и жизнеспособность сумме человеческой деятельности. С каждым поворотом мы накапливаем и заново вкладываем все больше человеческого капитала, действуем и взаимодействуем с постоянно возрастающей интенсивностью, пока расцвет гения не придаст нам еще большее ускорение (об этом пойдет речь в части II).

Положительным наследием эпохи Возрождения был всплеск гениальности – исключительные достижения в европейском искусстве, науке и философии, не имеющие аналогов в предшествующих столетиях, которые направили Европу к научно-технической революции и Просвещению последующих веков. Мы находимся в разгаре такого же всплеска, причем значительно более крупного масштаба. Мы можем с уверенностью утверждать это, поскольку, во-первых, условия совпадают, а во-вторых, об этом свидетельствует немалый список фундаментальных прорывов, которые мы уже совершили. Мы покажем, как силы, обозначенные в части I, способствуют расцвету гения в наши дни, и предскажем глубокие изменения, которые этот расцвет принесет человечеству. Мы также рассмотрим расширяющиеся возможности человечества в области коллективных достижений: нашу новую революционную способность к сотрудничеству и совместному использованию ресурсов, раздвигающую рубежи возможного. В эпоху Возрождения коллективными усилиями были созданы крупнейшие мировые соборы; сегодня массовая совместная работа позволяет находить новые методы лечения заболеваний, делает базу знаний человечества многоязычной и составляет карты видимой Вселенной.

Часть III, «Расцветающие опасности», уравновешивает надежды осторожностью. Те же соединяющие и развивающие силы, которые подпитывают человеческое воображение, усложняют жизнь и направляют нашу деятельность в опасное русло. Эти двойственные последствия повышают нашу уязвимость перед особой разновидностью опасности – системной опасностью. Пятьсот лет назад системные потрясения привели к тяжелейшим последствиям – неизвестные новые заболевания вспыхивали и распространялись с пугающей скоростью, разрушительные финансовые кризисы сотрясали новые кредитные рынки, и целые города, выросшие вдоль Великого шелкового пути, постепенно угасали после того, как открытие морского пути в Азию изменило мировые торговые маршруты. Мировой финансовый кризис 2008 г. уже научил нас с уважением относиться к этому виду опасности, но мы пока не можем оценить, насколько широко она распространена.

Системные опасности также растут в нашей национальной политике и геополитике. Эпоха Ренессанса рождает великие победы и великие поражения. Наши социальные договоренности слабеют, в то время как технологии, позволяющие сплотить людей или поднять протест, делаются общедоступными и набирают силу. Пятьсот лет назад костры тщеславия, религиозные войны, инквизиция и постоянные народные восстания рвали на части мир, в котором трудился гений, и погасили несколько ярчайших светочей той эпохи. Теперь голоса экстремизма, протекционизма и ксенофобии точно так же стремятся разорвать связи, подпитывающие современный гений, а общественное недовольство высасывает из наших государственных учреждений законность, необходимую для принятия решительных мер.

Путешествие заканчивается в части IV, «Борьба за будущее». Мы рассказываем о том, что всем нам – правительству, деловым кругам и гражданскому обществу – нужно сделать, чтобы достичь величия и преодолеть кризисы, которые принесет с собой это время. Сможем ли мы повторить славные деяния предыдущего Ренессанса, снова испытать его бедствия, или то и другое вместе? Это и есть главный вопрос, тот Голиаф, с которым всем нам придется столкнуться.

Внесем ясность

Но сначала мы должны разъяснить три вопроса.


Что на самом деле означает слово «Ренессанс»?

Историки во всем мире спорят об этом уже более ста лет. «Ни по времени, ни по масштабам, ни по содержанию, ни по значению понятие Возрождения не является определенным. Оно отличается расплывчатостью, незавершенностью и случайностью… Это почти непригодный к использованию термин» [10]. Эти строки написал голландский историк Йохан Хёйзинга в 1920 г. Прошло сто лет, но научные споры за это время не прибавили ясности. Основная претензия историков к слову «Ренессанс», или «Возрождение», заключается в том, что оно создает обманчивое впечатление об универсально благоприятной природе этого периода. Начало этому положил художник и историк Джорджо Вазари (1511–1574) в своей книге «Жизнеописания наиболее знаменитых живописцев, ваятелей и зодчих» (1550), в которой он воспевал новые художественные тенденции и отделял их от предшествующего готического стиля. Европейские историки XIX в. переняли этот термин и расширили его значение, соотнеся его в целом с эпохой художественного, культурного и интеллектуального расцвета (этот смысл сохраняется в некоторых фразах и сегодня, когда мы говорим, например, «ренессансный человек»). При этом они не просто бесстрастно описывали период, в который жили Леонардо, Микеланджело и их современники. Скорее они разрабатывали идею о том, что «ренессансная Европа», совершив скачок в развитии, обогнала другие цивилизации, – идею, которая стала первопричиной и оправданием европейского империализма XIX в. [11].

Сегодня историки непременно оговариваются, что в «ренессансной Европе» было немало уродливых явлений. Не будем забывать, что меньше чем через десять лет после того, как Микеланджело закончил роспись Сикстинской капеллы, оспа и другие европейские болезни почти уничтожили ацтеков, инков и прочие коренные народы Нового Света. Поэтому, используя слово «Ренессанс», историки делают это критически и с осторожностью, имея в виду в основном «возрождение» в Европе XV–XVI вв. определенных знаний, стилей и ценностей, унаследованных от Древней Греции и Древнего Рима.

В этой книге мы начнем с популярного сегодня значения этого термина, обозначающего редкий момент всеобщего расцвета. Это понятие – хорошая стартовая точка, поскольку оно прекрасно подходит для описания современного мира, в котором мы все живем. Но только если мы не забываем и об обратной стороне медали. На страницах этой книги мы подчеркиваем, что тогдашняя и нынешняя эпоха Ренессанса чревата как добрым, так и дурным, как гением, так и опасностью. Наконец, мы даем четкое определение: Ренессанс – это битва за будущее в момент, когда ставки особенно высоки.


Когда был Ренессанс?

История неразрывна – присмотритесь внимательнее, и вы сможете увидеть нити, тянущиеся из одной главы в другую. Ученые отмечают «начало» и «завершение» исторических этапов, чтобы упростить восприятие нашей общей истории и помочь уяснить ее общий курс, но такие линии должны наноситься только карандашом.

В этой книге мы будем оглядываться назад в основном на одно определенное столетие, с 1450 до 1550 г. 1450 г. может служить надежной точкой отсчета. Леонардо да Винчи родился в 1452 г., а в 1452–1454 гг. произошел ряд событий, благодаря которым вторая половина этого столетия стала совершенно не похожа на первую. Примерно в одно и то же время Англия и Франция завершили Столетнюю войну, безжалостно разрушавшую жизнь обеих стран с 1337 г., Константинополь, древняя столица, охранявшая восточные границы Европы более 1100 лет, наконец пал под пушками Османской империи, а враждующие итальянские державы – Милан, Венеция, Флоренция, Неаполь и Папская область – подписали соглашение о создании Итальянской лиги и договор о взаимном ненападении, который позволил всему полуострову отложить оружие и направить энергию в мирное русло [12].

По сходным причинам мы отмечаем 1990 г. как приблизительную дату начала Нового Ренессанса. В течение нескольких лет закончилась холодная война, пала Берлинская стена, Китай вернулся в мировую экономику и появился коммерческий интернет. Неожиданно мир стал совсем другим. Как мы увидим в части I, непреложные факты свидетельствуют, что этот период действительно отличался от всех предыдущих.

Предыдущий Ренессанс, по нашему мнению, закончился около 1550 г. За эволюцией идей и развитием событий следует наблюдать до тех пор, пока не станет ясно их значение в общей картине. Но на практике один век дает вполне внятное представление о многих переменах. Уже к 1550 г. стали очевидны и положительные, и отрицательные итоги эпохи – а вместе с ними мудрость и безрассудство решений, принятых людьми в это время.

Мы не беремся предсказать, когда закончится Новый Ренессанс. Но нынешняя «эпоха» шире, чем один этот год или одно десятилетие. Это феномен, противостояние, которое определит облик всего XXI в.


Почему именно Европа?

Периоды ренессанса, согласно нашему определению, можно найти у любой цивилизации. Процессы, происходившие в Европе в XV–XVI вв., имеют много общего с классическим периодом цивилизации майя (30–900), первыми веками правления корейской династии Чосон (1392–1897), Золотым веком ислама (750–1260), китайской династией Тан (618–907), государством Гуптов в Индии (320–550) и империей Великих Моголов в правление Акбара Великого (1556–1605). Мы призываем других исследователей подробнее исследовать эти периоды, чтобы получить более ясное представление о нашем настоящем. А наша книга задает перспективу, исходя из определенной точки европейской истории.

Почему? Отнюдь не потому, что Европа в XV в. была самой развитой цивилизацией своего времени. Это звание много веков удерживал Китай. Уже в XII в. тогдашняя столица Китая, город Кайфын, был мегаполисом с миллионным населением. За триста лет до Гутенберга китайские печатники освоили массовое производство книг, достаточно дешевых для того, чтобы их могли позволить себе держать даже в самых скромных домах [13]. Вступившая на восточный порог Европы Османская империя в XV–XVI вв. представляла собой намного более сложное космополитическое государство, чем те, о которых писал Макиавелли. Крупнейшим в мире религиозным сообществом были мусульмане, а не христиане. Европу рассматривали как провинцию, глубинку, и на многих картах XV в. она изображена именно так – с краю.

Но с приходом Ренессанса положение неожиданно начало меняться. В следующие несколько столетий Европа догнала, а затем перегнала все остальные цивилизации в большинстве областей человеческого прогресса и заложила основы того мира, в котором мы сейчас живем. Эта эпоха – ближайший родственник нашего времени, предлагающий нам самые непосредственные уроки.

Разумеется, подробности событий пятивековой давности во многом отличаются от наших дней. Но значит ли это, что мы должны игнорировать те уроки, которые прошлое может преподать настоящему, отбросить все, что оно может рассказать о расцвете гения и новых опасностях? Решайте сами. Мы думаем, вы придете к той же мысли: это Новый Ренессанс.

Часть I

Факты эпохи Ренессанса

Как мы здесь оказались, и что делает этот век особенным

1

Новый Свет

Как новые карты и новые средства связи преобразили мир, в котором мы живем

Новые карты

Среди необычайных, хотя и вполне естественных, обстоятельств моей жизни первое и наиболее примечательное то, что я родился в эпоху, когда перед нами открылся весь мир.

Джероламо Кардано (1501–1576) [1]

От открытия к наблюдению

В 1450 г. бо́льшую часть доступных сведений о мире Европа черпала из Библии. Земля существовала шесть тысяч лет. Всемирный потоп случился четыре с половиной тысячи лет назад. Народы Европы, Азии и Африки произошли от трех сыновей Ноя. Все это было общеизвестно и отражено на картах земной поверхности, которые назывались mappae mundi: на них Иерусалим помещался в центре мира, восток (откуда вставало солнце) располагался в верхней части, а по краям водились разнообразные чудовища.

Наиболее точной картой внешнего мира, доступной европейским ученым, была карта, составленная Птолемеем, греческим ученым, жившим во II в., чей главный труд в области картографии под названием «География» они обнаружили лишь недавно (около 1400 г.).


Эпоха открытий

Мир согласно Библии (около 1300 г.)

Рикардус де Белло. Terrarum Orbis (1285). Из архива Бодлианской библиотеки, Оксфордский университет


Эпоха открытий

Мир согласно описанию Птолемея (около 150 г.)

Йоханнес Шотт (1520) по данным Птолемея (II в.). Известный мир. Страсбург, Ballerman & Son. Из архива Бодлианской библиотеки, Оксфордский университет


Очевидно, этот картограф имел неплохое представление о Средиземноморье, Северной Африке, Аравийском полуострове и Ближнем Востоке. Но за пределами этих земель и вод точность его карты неумолимо снижается. Индийский океан на карте Птолемея (внизу справа) со всех сторон окружен сушей, Африка не имеет южной оконечности, у Индии не хватает полуострова, а Азия не имеет восточного побережья. Обе Америки и Тихий океан полностью отсутствуют. При этом масштабы крайне неточны. Птолемей считал, что его карта охватывает почти половину земного шара. В действительности она изображает менее одной пятой части одного полушария.

Европа в 1450 г. не имела данных, позволяющих исправить эти вопиющие ошибки[1]. Препятствия казались непреодолимыми, и было мало надежды на то, что это когда-либо удастся сделать. Путь на запад преграждала вода. Европейские ученые, как и Птолемей, знали, что мир должен быть круглым. Это было очевидно каждому, кто стоял на западном побережье Европы и восхищался едва заметным изгибом горизонта или пытался разгадать, почему парус приближающегося корабля всегда показывается первым, и только потом становится виден корпус. Но европейцы не знали, есть ли там еще суша и можно ли до нее добраться. Водная гладь была, в буквальном смысле, бесконечной. Страх перед огромными расстояниями, помноженный на веру в «истины», почерпнутые из Священного Писания и греческих мифов, заставлял большинство кораблей держаться в знакомых водах.

На востоке препятствие было еще более недвусмысленным: поле обзора Европы заканчивалось там, где начиналось турецкое владычество. Полиэтническая и полирелигиозная Османская империя при султане Мехмеде II в 1453 г. завоевала христианский Константинополь, тем самым перевернув последнюю страницу в истории некогда могучей Римской империи. В течение следующих ста лет военные победы османов на суше и на море вытеснили европейские державы (особенно торговые империи Венеции и Генуи) из восточносредиземноморского региона, со всего Балканского полуострова, с Черного моря, побережья Северной Африки и большей части Ближнего Востока.

Но в 1500 г. у Европы была уже совершенно другая картина мира. Новые факты, накопленные в результате морских путешествий и наблюдений, сначала поставили под сомнение, а затем начали опровергать старые истины. В 1487–1488 гг. португальский мореплаватель Бартоломеу Диаш открыл южную оконечность Африки. Десять лет спустя его соотечественник Васко да Гама обогнул ее, достиг восточного побережья Африки и через Индийский океан попал в порт Каликут (или Кожикоде), «Город пряностей». Его путешествие подтвердило, что Птолемей ошибался: Индийский океан вовсе не был со всех сторон окружен сушей. Эта новость поставила под угрозу существование городов, выросших вдоль Великого шелкового пути между Азией и Европой – оживленного и прибыльного сухопутного торгового маршрута, своим существованием обязанного ошибочному убеждению, будто аналогичного морского пути не существует. Меньшее значение для современников, но большее для мировой истории имело открытие, сделанное в 1492 г. Христофором Колумбом, который также искал новый морской путь в Азию и попутно обнаружил остров Эспаньола (ныне территория Республики Гаити и Доминиканской Республики). Он нашел Новый Свет[2].

Эти успехи подогревали азарт искателей истины и охотников за сокровищами. Португальцы продолжали осваивать морской путь на Восток, в Азию. Вернувшись в Лиссабон, да Гама привез с собой не так много сокровищ, но в течение следующих пяти лет более дюжины новых португальских экспедиций, общим числом около 7000 человек, выжали из его открытия максимум преимуществ. Вооруженные огнестрельным оружием, они завоевали Ормуз в 1507 г. (тогда, как и сейчас, это была стратегическая точка, позволявшая контролировать всю торговлю в Персидском заливе), западноиндийский порт Гоа в 1510 г. и Малакку, центр производства пряностей, в 1511 г. К 1513 г. они достигли южных портов Китая и практически установили монополию на торговлю через Индийский океан. Далее к западу испанский конкистадор Эрнан Кортес последовал по стопам Колумба и в 1504 г. высадился на Эспаньоле, распространив испанское владычество на Кубе (1511–1518) и во внутренних землях ацтеков, населявших территорию современной Мексики (1518–1520). Помимо богатых городов ацтеки владели самыми плодородными в мире пахотными землями и сложной ирригационной системой, позволявшей собирать большие урожаи кукурузы, кабачков и бобов. Французы, не желавшие ни на шаг отставать от соседей в этот новый век создания империй, в 1524 г. отправили Джованни да Верраццано к восточному побережью Северной Америки, а в 1534 г. послали Жака Картье в первую из трех экспедиций вверх по течению реки Святого Лаврентия.



Но, пожалуй, самым амбициозным было плавание Фернана Магеллана (1480–1521), который в 1519 г., подобно Колумбу, отплыл из Испании на запад в поисках пути в Азию. Он предположил, что, как и в случае с Африкой, южную оконечность Южной Америки можно будет обогнуть по морю и что так он сможет достичь Островов пряностей (Индонезии) гораздо быстрее, чем если бы двинулся на восток. Магеллан был отчасти прав. Он действительно нашел южный проход, и в его честь был назван Магелланов пролив. Кроме того, на другой стороне он обнаружил новый океан, который назвал Тихим за его благоприятные ветры.

Выбрав такое название, Магеллан выдал последнее крупное заблуждение Европы о мировой географии. По-прежнему опираясь на древние карты Птолемея, он считал, что от Испании до Азии на запад около 130° долготы [2]. На самом деле это расстояние равняется 230°, и разницу составляет как раз Магелланов так называемый Тихий океан. Самый большой и самый бурный океан в мире, он занимает 130 миллионов квадратных километров – треть всего земного шара. 237 человек на пяти кораблях отплыли из Испании на запад. Через три года, пережив голод, убийства, мятежи и кораблекрушения, один корабль с восемнадцатью членами команды вернулся, и их кругосветное путешествие дало Европе окончательное и ясное представление о размерах и форме Земли.

Вершиной картографических успехов эпохи Великих географических открытий стала карта мира, составленная в 1569 г. Герардом Меркатором (1512–1594). Он отразил в своей работе десятилетия открытий, навигации и картографии, и полученный результат заменил карту Птолемея в качестве наиболее точного изображения поверхности планеты. С некоторыми уточнениями – Австралию заметили только в XVII в. – она остается основным шаблоном, на основе которого мы и сегодня продолжаем создавать карты.


Эпоха открытий

Мир согласно описанию Меркатора (1569)

Rumold Mercator (1569). Nova et Aucta Orbis Terrae Descriptio ad Usum Navigantium Emendate Accommodata. Antwerp: Plantin Press. Из архива Национальной библиотеки Франции


Карта Меркатора не просто свела воедино новые данные. Она заложила основы новой и даже (в условиях по-прежнему глубоко религиозной эпохи) несколько кощунственной философии, гласящей, что знания, полученные в результате непосредственного наблюдения (Книга Природы), могут отличаться, а то и прямо противоречить мудрости древних и откровениям, явленным в Священном Писании (Книге Бога). Живописные морские чудовища, религиозные символы и неопределенные загогулины на картах сменились стрелкой компаса, указывающей точно на север, узнаваемыми береговыми линиями и точно нанесенными долготами и широтами. Азия и Африка уменьшилась до своих истинных размеров, а Европа, которую Птолемей поставил с краю, была помещена в центр в знак признания ее новой роли законодателя мировых тенденций. Так возник новый мир.


От идеологии к рыночной экономике

Всего тридцать лет назад мы сами столкнулись с непреодолимой преградой. На этот раз ею оказался не океан, а идеология. Однако она также отражала противостояние между силой власти, диктующей истину, и силой наблюдения, выявляющего альтернативы.

Мы не знали тогда того, что знаем теперь: засилье централизованного планирования обрекает государства на экономическую стагнацию и крах. В 1970-е гг. коммунизм казался стойкой и действенной альтернативой капиталистическому подходу, практиковавшемуся в демократических странах. В конце концов, коммунизм работал. Коммунистические страны в целом доказали, что они в состоянии обеспечить своих граждан основными благами – питанием, образованием, здравоохранением, а Советский Союз достиг в науке, и не в последнюю очередь в освоении космоса, крупных успехов, вызывавших опасение и зависть у наблюдателей из капиталистических стран.

Таким образом, человечество разделилось – политически с помощью железного занавеса и физически с помощью Берлинской стены, – и завязалась борьба между двумя взаимоисключающими (и ядерно вооруженными) взглядами на мир. По одну сторону оказались страны первого мира: Северная Америка, Западная Европа, Азиатско-Тихоокеанский регион и их союзники, по другую – страны второго мира: Советы (начиная с большевистской революции 1917 г.), Восточная Европа (оказавшаяся под влиянием Советского Союза после Второй мировой войны), Китай (с основания в 1949 г. Китайской Народной Республики) и другие коммунистические государства. Остальные страны получили название третьего мира. Поскольку многие из них были бедными, постепенно этим термином стали обозначать слаборазвитые страны в целом (сейчас это наименование считается уничижительным).

На сегодняшний день эта карта устарела.

К 1980 г. недостатки централизованной плановой экономики – громоздкие отрасли промышленности, высосанные из пальца стимулы, незаинтересованные работники – стали болезненно очевидными, и даже самым крупным державам пришлось склониться перед экономической реальностью. Дэн Сяопин открыл Китай, и его экономика, опирающаяся на миллиардное население, начала упорядочивать торговые отношения с Западом. Президент СССР Михаил Горбачев объявил о начале перестройки. Экономический коллапс в ряде стран, от Филиппин до Замбии, Мексики, Польши, Чили, Бангладеш, Ганы, Кореи, Марокко и др., толкнул их на поиски оптимальной модели роста. Концепция импортозамещения, согласно которой страны отгораживались друг от друга торговыми барьерами в надежде, что это поможет развитию собственной промышленности, оказалась нежизнеспособной: промышленность не могла достичь нужного масштаба и качества, работая только на удовлетворение внутреннего спроса, и была недостаточно сильна, чтобы участвовать в свободной конкуренции вне искусственных тарифных ограничений. Все больше стран попадало в водоворот растущих долгов и инфляции. Им пришлось обратиться к Всемирному банку и Международному валютному фонду (МВФ), которые в обмен на помощь настояли на принятии нового экспортоориентированного подхода: снятие торговых барьеров, допуск иностранных инвестиций и иностранных конкурентов, защита частной собственности, а также поощрение интеграции в глобальные финансовые и производственные структуры. Меньше чем за десять лет к мировому рынку присоединилось более 4 миллиардов человек [3].


Эпоха открытий

Политическая картина мира (около 1980 г.)

Center for Systemic Peace (2015). Polity IV Project, Political Regime Characteristics and Transitions, 1800–2014. Integrated Network for Societal Conflict Research. По материалам www.systemicpeace.org/inscrdata.html


Президент СССР Горбачев считал, что коренная причина бедствий его страны заключается в политике, поэтому он преобразовал капиталистическую волну в демократизирующую. В 1989 г. движение «Солидарность» в Польше завоевало для поляков право избирать руководство собственной страны. В течение двух лет Венгрия, Болгария и Чехословакия выбрали для себя демократическое будущее, а в Восточной Германии была снесена Берлинская стена. В декабре 1991 г. Советский Союз прекратил существование, в России впервые в истории страны был избран президент, которым стал Борис Ельцин, и демократия начала распространяться по всей Северной Азии.

Холодная война сменилась оттепелью, и население, до этого принужденное подчиняться авторитарным властям, в той или иной мере преследовавшим соблюдение геополитических интересов и государственной безопасности, начало все решительнее выражать протест против концентрации власти и богатства внутри страны. В 1980 г. большей частью Латинской Америки правили военные хунты (Гватемала, Бразилия, Боливия, Аргентина, Перу, Панама, Парагвай, Гондурас, Чили, Уругвай, Суринам и Сальвадор). К 1993 г. все они были свергнуты в ходе демократических революций. В тот же период власть перешла в руки народа в из 46 стран Центральной и Южной Африки, в том числе в Южно-Африканской Республике, хотя, по мнению многих, там понадобилось бы несколько поколений, чтобы положить конец режиму апартеида. Таким образом, с 1970 г. по сегодняшний день число формально демократических государств в составе ООН увеличилось с до [4].


Эпоха открытий

Политическая картина мира (около 2015 г.)

Center for Systemic Peace (2015). Polity IV Project, Political Regime Characteristics and Transitions, 1800–2014. Integrated Network for Societal Conflict Research. По материалам www.systemicpeace.org/inscrdata.html


Конечно, политические разногласия сохраняются. Если под демократией понимать: 1) власть большинства, определенную в результате свободных и справедливых выборов, 2) защиту меньшинств, 3) соблюдение основных прав человека и 4) юридическое равенство граждан, то при демократии живут лишь около 47 % стран, или 48 % населения мира [5]. Во многих странах демократия находится под угрозой. Усиленное наступление на свободу средств массовой информации происходит в странах Латинской Америки, в Турции, Венгрии, на Ближнем Востоке и в Северной Африке, где власти нервно адаптируются к ухудшению экономических условий. В странах с развитой демократией наблюдается спад участия избирателей в общественной жизни, а гражданские свободы снова ущемляются из соображений общественной безопасности. (С тех пор как Эдвард Сноуден в 2013 г. объявил во всеуслышание, что Агентство национальной безопасности осуществляет тайный надзор за частной перепиской граждан, этот некогда замалчиваемый компромисс не раз бурно обсуждался, но так и не был упразднен.) С другой стороны, «арабская весна» (начавшаяся в 2010 г. волна революций в арабском мире), роспуск военной хунты Мьянмы в 2011 г., ростки политической реформы на Кубе, «зонтичная революция» (движение за демократию) в Гонконге в 2014 г. и даже меняющаяся риторика Коммунистической партии Китая дают понять, что сегодня демократия в той или иной форме является необходимым условием легитимности во всем мире.

В 1990-е гг., по мере постепенного распространения «власти народа», лакмусовой бумажкой успехов политического руководства стали экономические достижения. С тех пор как угроза Советского Союза и коммунистического Китая отступила на второй план, политический прагматизм и глобальная безопасность перестали занимать главное место в умах избирателей, и в центре внимания оказались более приземленные соображения: занятость, образование, здравоохранение и питание, инфраструктура и технологии, стабильность валюты и безопасность окружающей среды. «Это экономика, дурачок», – смело произнес Билл Клинтон в 1992 г. в ходе своей предвыборной борьбы против Джорджа Г. У. Буша – действующего президента, чьи неоспоримые достижения во внешней политике вдруг перестали иметь значение.

Растущий глобальный консенсус, поставивший во главу угла экономический рост, во многом сгладил еще сохранявшиеся между государствами политические разногласия. Во Всемирной торговой организации (ВТО), ставшей символом этого консенсуса с момента своего основания в 1995 г., в настоящее время насчитывается более 160 участников, в том числе все крупные мировые державы (последний большой «уклонист», Россия, присоединилась к ВТО в 2012 г.) [6]. С помощью ВТО мы не только распахнули друг перед другом двери, но и переставили мебель – настроили наши внутренние правила и организации, чтобы сгладить различия при деятельности в рамках чужой экономики. Импульс глобальных торговых операций в последние годы ослабел – финансовые, социальные и экологические кризисы охладили когда-то подпитывавшую их риторику «главное – это рост», но 20 лет переговоров и урегулирования споров в рамках ВТО уже сломали глобальные торговые барьеры. В странах с развитой экономикой средние тарифы на импорт уже близки к нулю, а нынешние региональные торговые инициативы – Транс-Тихоокеанское партнерство (ТТП) между США и одиннадцатью государствами Тихоокеанского региона и Трансатлантическое торговое и инвестиционное партнерство (ТТИП) между США и странами Евросоюза (ЕС) – работают над разрушением многих нетарифных барьеров[3]. Региональные объединения – ЕС (создан заново в 1993 г.), Североамериканское соглашение о свободной торговле (НАФТА, с 1994 г.), зона свободной торговли Ассоциации государств Юго-Восточной Азии (АСЕАН, 1992), общий рынок стран Южной Америки (МЕРКОСУР, 1991) и Сообщества развития юга Африки (САДК, 1992) – способствуют урегулированию политических и экономических вопросов между близкими соседями.

Лишь одна страна, Северная Корея, по-прежнему отвергает глобальный рынок. Но даже там идея постепенно пускает корни. Пхеньянская элита теперь выпивает около 2500 тонн импортного кофе в год (в 1998 г. этот показатель был равен нулю) и общается с помощью 2,5 миллиона смартфонов (в 2009 г. этот показатель также был равен нулю) [7]. В настоящее время почти все население земного шара экономически связано между собой, в то время как в 1980-е гг. таких людей было менее 50 %.

Демократическая риторика и рыночная экономика совершили кругосветное путешествие.

Новые СМИ

Гутенберг

Новшества ренессансного мира касались не только материального пространства, они распространялись и в области мысли. Параллельно с формированием новых отношений на земле и на море трансформировались и способы распространения идей.

Человеческий глаз с трудом различает даже знакомые лица на расстоянии 30 метров, человеческое ухо в обычных обстоятельствах не способно уловить разговор на аналогичном расстоянии. Чтобы преодолеть большее расстояние, мы должны установить друг с другом контакт качественно иным способом. В 1450 г. Иоганн Гутенберг (около 1395–1468), немецкий предприниматель из города Майнца, предложил способ, которому суждено было обрести мировую известность. Его изобретение представляло собой тонкое сочетание инноваций: ручные формы, позволявшие быстро отлить тысячи маленьких металлических букв (или «литер»), рама, в которую можно было устанавливать эти литеры, складывая слова и предложения, а также формула чернил на масляной основе, которые одинаково хорошо держались на металлической литере и впитывались под прессом в лист бумаги. В этот котел он бросил еще два широко известных местных ингредиента: пресс (технология, известная в Европе с древних времен, хотя обычно его использовали для переработки оливок и винограда) и бумагу. Бумага появилась в Европе тремя веками раньше через испанских мавров, которые, в свою очередь, переняли идею у китайцев. Бумага была дешевле, чем пергамент (который изготавливали из кожи животных), и ко времени жизни Гутенберга в Германии ее производили полдюжины фабрик.

Результатом стал первый в мире печатный станок, который произвел революцию в области коммуникаций[4]. Человек, родившийся в середине 1450-х гг., в то время, когда появилась первая в мире печатная книга (Библия Гутенберга), в свой пятидесятый день рождения мог оглянуться назад и обнаружить, что за этот не слишком большой срок было напечатано около 15–20 миллионов книг – больше, чем создали все писцы Европы, вместе взятые, со времен Древнего Рима [8]. Этому человеку, вероятно, было бы сложно представить себе мир без этих внезапно ставших повсеместными объектов – мир, где передать информацию можно было только устно при личной встрече либо с помощью рукописного текста, где человек, считавшийся хорошо образованным, прочитал, возможно, десяток рукописей, а чтобы прочесть больше, ему нужно было совершить долгое паломничество в Папскую библиотеку в Авиньоне (до Гутенберга одна из крупнейших европейских библиотек, в которой хранилось более двух тысяч томов) или в один из главных монастырей христианского мира.

Теперь же все изменилось. Всего за полвека один печатный станок превратился в сеть из 250 типографий по всей Европе, и общая сумма созданной за полторы тысячи лет европейской письменной культуры увеличилась вдвое. В следующие 25 лет она снова увеличилась вдвое. Рост контента стал из градуального экспоненциальным.


Итоги

Появление этого нового средства, типографской печати, неумолимо вытеснило устаревшие прежние методы.

Оно перевернуло экономику изготовления книг, превратив то, что когда-то было бесценным артефактом, в общедоступный дешевый товар. Немецкий писатель Брант (1457–1521) заметил в 1498 г.: «С помощью печатного станка человек в одиночку может произвести за день столько же, сколько раньше он мог бы переписать от руки за тысячу дней» [9]. И он не преувеличивал. В 1483 г. типография Риполи брала три флорина за подготовку и издание тиража «Диалогов» Платона в формате quinterno (пять листов бумаги, сложенных пополам в виде блокнота). Писец просил меньше, скажем, один флорин, но он производил только одну копию. А типография Риполи выпускала за меньшее время 1025 экземпляров [10].


Эпоха открытий

Сеть типографий в Европе (1500)

Greg Prickman (2008). The Atlas of Early Printing. University of Iowa Libraries. По материалам atlas.lib.uiowa.edu


Печать способствовала стандартизации обучения. Раньше каждая книга была уникальной. Разные шрифты, иллюстрации и номера страниц, преднамеренные и непреднамеренные вставки, пропуски и другие особенности – все это означало, что двух абсолютно идентичных копий одной книги не существует. Книгопечатание не устранило эти особенности полностью, но значительно сократило их количество. Теперь, когда люди изучали Цицерона, они с большей вероятностью читали один и тот же текст, а если один экземпляр каким-то образом погибал, у ученых оставалось много заслуживающих доверия запасных копий. Это имело далеко идущие последствия, не в последнюю очередь для науки и ее новых отраслей: ботаники, астрономии, анатомии и медицины. Совместимые с печатным станком ксилографии и гравюры заменили выполненные вручную иллюстрации. Впервые появилась возможность снабжать почти идентичными детализированными изображениями, чертежами и картами разбросанных по всему свету ученых и мореплавателей. Подробные, насыщенные информацией изображения, такие как иллюстрации к сочинению Везалия «О строении человеческого тела» (De humani corporis fabrica libri septem, 1555), детально изображающие строение мышечной системы человеческого тела, до Гутенберга были просто невозможны.


Эпоха открытий

Типографская печать сделала возможным распространение сложной визуальной информации

Андреас Везалий (1543). De humani corporis fabrica libri septem. Basil: Johann Oporinus. Из архива Национальной медицинской библиотеки США


Книгопечатание сделало знания доступными. До эпохи книгопечатания знание больше напоминало огороженный сад. Большинство текстов было написано на латыни (перелезть через этот забор могли лишь образованные представители знати), а опыт в университетах и в ученичестве передавали устно. Новые написанные на понятном национальном языке и пестрящие картинками книги сделали знания «общими», распространили их среди подмастерьев, лавочников и клерков, пробудили в населении интерес к грамотности и чтению[5]. Вместе с тем широкое издание книг, посвященных истории, философии и миру природы, дало ученым возможность обойти академические рогатки. «Почему стариков следует предпочитать молодым в наше время, когда молодые люди посредством прилежной учебы могут получить те же знания?» – интересовался монах Джакомо Филиппо Форести (1434–1520) в 1483 г. [11]. Многие молодые люди задавались тем же вопросом. Один из выдающихся астрономов XVI в. Тихо Браге (1546–1601) обучился своему искусству самостоятельно, в основном по книгам, которые публиковали Коперник и другие ученые.

Книгопечатание расширило и географический диапазон распространения знаний. В XV–XVI вв. Европа была занята в основном обнаружением и присвоением природных и человеческих ресурсов на других континентах, но вместе с тем она сама добавила в этот котел один крупный ингредиент: западные знания и идеи. Дешевые и легкие, книги преодолевали огромные расстояния. Indulgentiae ecclesiarum urbis, путеводитель до Рима (основное место паломничества в западном христианском мире), был к 1523 г. продан в 44 латинских изданиях и 20 изданиях на национальных языках по всей Европе и Средиземноморью [12]. Печатные гравюры из Антверпена в начале XVI в. можно было найти всюду, куда заплывали европейцы, в том числе в Индии, Китае, Японии, Мексике и Перу, – через них местные художники знакомились с европейскими формами и художественными стилями [13]. Вооруженные Библией миссионеры распространяли европейские и иудеохристианские представления о суверенитете, собственности, Боге, грехе и спасении, в также отношениях человека с природой в колониях Нового Света и среди азиатских торговых партнеров [14].

Книгопечатание также расширило спектр контента, доступного для общественного потребления, и степень участия общественности в его создании. Первыми были набраны и отпечатаны религиозные тексты. Потом пришла очередь римских писателей (Цицерон, Вергилий, Ливий, Гораций). Вслед за ними были изданы более ранние греческие авторы (сначала на греческом языке, потом на латыни), а затем их труды переиздавались снова и снова, на этот раз на национальных языках (в основном на французском, английском и итальянском). Сочинения древнегреческих авторов пережили Средневековье в редких, часто неточных переводах, но в XV в. в западных библиотеках стали появляться полные греческие тексты. Ученые отправлялись в Константинополь (в то время находившийся под греческим владычеством) и восстанавливали их из достоверных источников. Когда Константинополь пал под натиском турок, этот ручеек превратился в мощный поток. Греческие художники и ученые, недовольные османским владычеством, устремились на Запад, в Италию, держа под мышкой потрепанные томики Платона и Птолемея. Неожиданно классическое греческое наследие вернулось в целостности и первоначальной ясности, вызванное к жизни переводчиками – носителями языка. Западноевропейские интеллектуалы жадно набросились на сокровищницу античных достижений в области философии, математики, астрономии, биологии и архитектуры. Благодаря книгопечатанию прошлое было заново открыто, а его ценности сохранены в переводах для нынешнего и будущих поколений.

Но «классика», как впоследствии стали называть греческие и латинские тексты, сама по себе не могла обеспечить занятость растущего числа европейских типографий.

Сама цель публикации книг расширилась от сохранения мудрости прошлого и распространения религиозных взглядов до пропаганды новых идей и нового опыта. Возник новый формат – памфлет, – и это расширило возможности для самовыражения. Короткие, быстро появляющиеся и дешевые печатные брошюры были твитами пятисотлетней давности. Торговцы, клерки, ремесленники и другие специалисты, а также проповедники с 1500 по 1530 г. опубликовали около 4000 листовок на разные темы [15]. Памфлеты позволяли ученым быстро связать свое имя с новым открытием или доказать несостоятельность мнения конкурентов. Одно только Великое сближение Юпитера и Сатурна в 1524 г. спровоцировало издание около 160 брошюр, написанных шестьюдесятью авторами (большинство из них разжигали панику и предвещали близкий конец света) [16]. Другие памфлеты стремились предвосхитить бедствия и политические кризисы и снабдить обеспокоенную общественность фактами (и домыслами) о том, кто потерпит крах, а кто его избежит. Мартин Лютер случайно положил начало протестантской Реформации, когда его листок с жаркой критикой католической церкви, прибитый к дверям местной церкви в 1517 г., был переиздан и распространился в европейских масштабах. (Подробнее см. главу 7.)

Но ни одно из этих последствий не наступило мгновенно – обществу потребовалось время, чтобы адаптироваться к новым условиям. Писцы продолжали трудиться еще несколько десятилетий, а через сто лет после изобретения книгопечатания консерваторы по-прежнему указывали на недостатки этой технологии. Например, иногда она способствовала распространению ошибочных данных (самый яркий пример – так называемая Грешная Библия, изданная в Лондоне в типографии Роберта Баркера в 1631 г.; седьмая заповедь в ней гласила: «Прелюбодействуй»). Но книгопечатание оказалось слишком полезным и слишком быстрым, чтобы его можно было остановить. Глава Библиотеки Ватикана Джованни Андреа Бусси размышлял в 1470 г.: «Едва ли можно отыскать изобретение, имевшее подобную важность для человечества, будь то в древние или нынешние времена» [17].


Цукерберг

Сегодня мы можем это сделать. Зарождение новых, цифровых средств сбора, передачи и обмена информацией – второй гутенберговский момент в нашей истории.

В оцифрованном виде аналоговый мир, в котором мы живем, – книги, речь, футбольные матчи и прикосновения к сенсорному экрану, – выглядит как последовательность нулей и единиц. Как и азбука Морзе, для человека эта система слишком громоздкая («громоздкий» переводится как 01110100011001010110010001101001011011110111010101110011»), но она удобна для компьютера, поскольку различие между нулем и единицей, «вкл» и «выкл» совершенно ясно. В ходе преобразования мы теряем часть информации (гладкая аналоговая звуковая волна в цифровом формате превращается в ступенчатый зиккурат), но в качестве компромисса получаем взамен вычислительную мощность машины. При этом мы умеем быстро наращивать эту мощность. В 1965 г. соучредитель компании Intel Гордон Мур отметил, что число транзисторов, которые его компания может разместить на компьютерной микросхеме (и, следовательно, вычислительная мощность микросхемы), удваивается примерно каждые два года. «Закон Мура», как его назвали, до сих пор остается в силе.

Это, пожалуй, самое важное эмпирическое наблюдение нашего времени. Одной из определяющих особенностей первого гутенберговского момента была скорость: в течение одной человеческой жизни возникло и повсеместно распространилось новое средство развития культуры и коммуникации. То же самое происходит сейчас и с нами. Рассмотрим материальную инфраструктуру, лежащую в основе этого процесса. В XV в. эта инфраструктура состояла из типографий, сегодня это наземные и подводные оптоволоконные кабели. Первый межконтинентальный оптоволоконный кабель был проложен в 1988 г. С тех пор рост вычислительных мощностей и увеличение объема передаваемых данных превратили отдельные редкие нити в густую сеть. И число пользователей этой инфраструктуры выросло более чем в семь раз – с 400 миллионов на рубеже тысячелетия до 3 миллиардов сейчас [18].

Это самое быстрое массовое внедрение технологии, когда-либо случавшееся в истории. По крайней мере, так было, пока мы не уменьшили цифровые устройства и не сделали их мобильными. Совсем недавно, в 1998 г., только 20 % жителей развитых стран и 1 % жителей развивающихся стран имели сотовые телефоны [19]. Теперь в развитых странах количество абонентов мобильной связи превышает количество людей, а в развивающихся странах распространение сотовой связи достигло 90 % [20].


Эпоха открытий

Зарегистрированные пользователи интернета в развитых и развивающихся странах


Эпоха открытий

Абоненты мобильной связи в развитых и развивающихся странах

Всего за 20 лет почти все человечество оказалось соединено с помощью голоса или данных. World Bank Databank (2015). World Development Indicators. По материалам data.worldbank.org


Почти треть пользователей мобильных сетей теперь могут получить со своего телефона доступ в интернет [21]. Единственное, что в человеческой культуре сейчас растет быстрее, чем использование цифровых мобильных устройств, – это количество передаваемой с их помощью информации, главным образом потому что каждый год мы производим миллиарды новых, более совершенных устройств для сбора и обмена данными. К этим устройствам относятся не только смартфоны, но и сетевые автомобили, посудомоечные машины, магнитно-резонансные томографы и гигантские радиотелескопы. В 2011 г. на планете было столько же сетевых устройств, сколько людей. В 2015 г. устройства превосходили нас числом в соотношении 3:1. С их помощью человечество в течение одного года создало, скопировало и распространило около 44 зеттабайт данных. Это очень много – представьте цифру 44 с 21 нулем. Чтобы слегка расширить перспективу: эти данные заполнили бы стопку 128-гигабайтных смартфонов высотой 250 тысяч километров – две трети расстояния до Луны. И эта стопка «вырастает» вдвое каждые два года. Совсем недавно, в 2005 г., ежегодный массив данных занимал расстояние «всего лишь» от Майами до Лондона [22].


Новые итоги

Цифровые средства передачи информации, как когда-то книгопечатание, перевернули экономику процесса сбора и обмена данными. Благодаря закону Мура и сопутствующему стремительному росту вычислительных мощностей цифровой интерфейс придвинулся непосредственно к человеку – к губам и ушам каждого, перед лицом и на кончиках пальцев, – и теперь мы можем запечатлеть и разделить с другими все наши мысли и слова в цифровом формате. Кроме того, эти мысли и слова отныне обладают дополнительными цифровыми характеристиками, а именно: их можно копировать бесконечное количество раз при близкой к нулю стоимости; их можно потреблять, редактировать и перерабатывать, одновременно или последовательно, сотни, тысячи или миллионы раз; их можно сжимать, отправлять на хранение, создавать резервные копии и извлекать при необходимости; их можно усиливать или повторно передавать на любое расстояние со скоростью света и почти нулевой потерей сигнала. Эти характеристики сделали расстояние, время и стоимость почти несущественными факторами в процессе обмена и распространения идей.

Еще в 2001 г. средняя стоимость телефонных звонков на дальние расстояния, скажем, между США и Великобританией, составляла до $1,75 в минуту, и мы старались экономно расходовать эти минуты. Сегодня благодаря цифровым услугам, таким как Skype, стоимость связи снизилась практически в 100 раз, и мы почти перестали о ней думать. Объем международных звонков вырос по сравнению с 2001 г. почти в четыре раза, с 150 миллиардов до 600 миллиардов минут [23]. Расстояние все еще имеет значение только при совершении телефонного звонка между разными часовыми поясами – и в этом заключается одна из причин бурной популярности асинхронных способов контакта, таких как WhatsApp и Facebook Messenger.

Еще одна роскошь, ныне доступная каждому, – хранение и обработка данных онлайн, или облако. Сейчас Google бесплатно предоставляет каждому из почти миллиарда пользователей своих облачных сервисов возможности онлайн-хранения стоимостью около 15 тысяч долларов по ценам 1995 г. Другими словами, услуга, которая всего 20 лет назад стоила бы в совокупности 15 триллионов долларов, теперь стала бесплатной [24]. Не только значительная часть общественных знаний, но и наши частные библиотеки – письма, фотографии, музыка и корпоративные базы данных – доступны нам в любой точке мира, в любой момент. «Облако» – эффектная, но вводящая в заблуждение метафора. Скорее этот сервис можно сравнить с кожей – всегда на кончиках пальцев, неотделима от нашей личности.

Книги и содержащиеся в них идеи путешествовали по всем сухопутным и морским путям, проложенным на новых картах Европы. То же самое происходит сегодня с цифровыми данными. Селфи, сделанное Эллен Дедженерес с семью другими знаменитостями на церемонии вручения премии «Оскар» в 2014 г., в течение всего 12 часов сгенерировало 2 терабайта трафика и было загружено на 26 миллионов устройств по всему миру. В 2013 г. глобальный поток данных за один день преодолел барьер в один эксабайт – то есть обмен данными за один день превысил общий годовой трафик в 2003 г. Трафик в 2014 г. вырос еще в 1,5 раза [25]. По мере увеличения числа пользователей (к 2017 г. оно может достигнуть 5 миллиардов), каждый из которых потребляет все больше контента (особенно видео), общий объем потока данных будет по-прежнему расти и расширяться [26].

Между тем оживленные перекрестки переместились из США в Западную Европу, которая стала основным центром обмена данными с Восточной Европой, Ближним Востоком и Африкой [27]. Десять лет назад слаборазвитая инфраструктура отбросила многие развивающиеся страны на задворки цифрового века. Теперь умные мобильные устройства помогли им преодолеть эти барьеры. В 2015 г. больше людей имели доступ к 2G-сотовой связи (95 % всего населения мира), чем к электричеству (82 %) [28][6].


Международные потоки данных

Эпоха открытий

Теперь потоки данных между континентами стали шире James Manyika, Jacques Bughin, et al. (2014). Global Flows in a Digital Age. New York: McKinsey Global Institute; Cisco (2015). Visual Networking Index. По материалам www.cisco.com плюс авторский анализ


Цифровые средства передачи данных также помогли стандартизировать связь – прежде всего с помощью обмена видео. Размещение видео стало целесообразным только после массового перехода на фиксированный широкополосный доступ в интернет (который к 2015 г. соединял 11 % домохозяйств во всем мире) [29]. Видео требует широкополосных каналов не без причины: оно лучше передает сложные понятия, более полно задействует наш мозг и сокращает потери данных по сравнению со статическим изображением и аудио. Возможно, эти достоинства не так бросаются в глаза, когда вы делаете будничный звонок родителям жены или мужа, но они становятся совершенно очевидными, если вы объясняете, что такое «жизнеспособность клеточных конструктов, созданных из биоматериала с помощью трехраздаточного картезианского принтера», как в статье от 2015 г. в журнале JoVE (Journal of Visualized Experiments, «Журнал визуализированных экспериментов») [30].

Переход на цифровой формат вывел на новый уровень свободу слова. Двадцать лет назад мы разделяли коммуникацию на «частную» (один на один) и «общественную» (один обращается ко многим или многие ко многим). В то время как для первого вида существовали дешевые средства массовой связи (телефон, почта), второй вид был связан с высокими затратами и осуществлялся через особые каналы – газеты, книги, кассеты и электромагнитные сигналы (телевидение, радио). Как правило, только корпоративные или государственные структуры (издательства, медийные компании, теле– и радиостанции) могли позволить себе создавать такие каналы, и они пропускали только те сообщения, которые служили их целям.

Сегодня это различие почти забыто. Открытое распространение данных стало таким же дешевым. Мы так же, как когда-то Тихо Браге, можем спросить себя: зачем слушать старые голоса вместо новых, когда у каждого есть возможность говорить со своей аудиторией напрямую? Этот в высшей степени резонный вопрос вверг в состояние кризиса все традиционные СМИ. Задача газетной журналистики состоит уже не в сборе «всех новостей, пригодных для печати», – теперь речь идет об отборе контента и привлечении внимания к точке зрения редакции в надежде занять какое-то место в жизни читателей и в новостных лентах. Роль школ и учителей тоже меняется. Работа хорошего учителя заключается уже не просто в передаче информации. Студенты в обществах с развитой связью имеют доступ ко всем знаниям мира, и загрузка этих знаний в мозг студентов дает лишь незначительное социальное преимущество. Сегодня работа учителя заключается в том, чтобы научить студентов добывать нужную информацию, подвергать ее критическому анализу, объединять полученные данные и сопоставлять их с собственными исследованиями и мнениями.

Тем, кто хочет добавить свой голос к хору глобального обмена информацией и идеями, наш гутенберговский момент предлагает множество способов осуществить это намерение. Типографии привели к появлению романов, эссе и брошюр, цифровые средства передачи данных привели к появлению блогов, видеоканалов, коллажей, твитов, досок в Pinterest и к бесконечному разнообразию виртуальных товаров – приложений и электронных книг. В первое десятилетие существования интернета его польза состояла главным образом в быстром и дешевом распространении информации. Теперь, в условиях широкополосного доступа и мобильной связи, он приглашает пользователей к совместному созданию контента (Quora для сбора фактов, GitHub для программирования или Thingiverse для создания дизайнов 3D-печати), обмену мнениями на порталах, где публикуются авторские колонки (The Huffington Post или Project Syndicate), или участию в научных проектах (Open Tree of Life). Все эти новые формы имеют одну общую характеристику: они подразумевают превращение аудитории в участников – переход от потребителя к производителю и дистрибьютору контента.

И наконец, мы создаем новый уровень группового интеллекта. Мы можем собираться, чувствовать, говорить и действовать сообща – легче, быстрее и эффективнее. Мы помогаем друг другу находить потерянных детей или получать помощь в кризисных ситуациях. Мы можем больше узнать о том, что думают и чувствуют наши соотечественники. Если бы Facebook был нацией, это была бы самая многочисленная нация на Земле – более полутора миллиардов активных пользователей каждый месяц [31]. И, хотя они разбросаны по всему миру, в среднем все они находятся друг от друга менее чем в четвертой степени удаления [32]. В Facebook, даже если мы никогда не встречались, друг вашего друга знает друга моего друга.

Этот новый групповой интеллект сыграл ключевую роль во многих громких событиях XXI в.: «арабская весна», международное движение «Захвати», общественные усилия по оказанию помощи в ликвидации последствий урагана «Сэнди», Парижское климатическое соглашение и рост экстремистских политических партий в Европе. Широкий спектр этих событий подчеркивает, что новая цифровая среда может приносить как пользу, так и вред. Государства и отдельные граждане еще не до конца разобрались, как работает этот слой сознания и как им управлять. Оно помогло становлению Исламского государства Ирака и Леванта (ИГИЛ)[7] – но вместе с тем и возникновению новых арабских светских движений, отвергающих не только религиозное насилие, но и слияние власти и религии вообще (см. главу 7). Это непросто, но это уже меняет нас. «Воля народа», «общественный договор» и «настроения в стране» – эти некогда абстрактные термины, которые можно было услышать только на кафедре философии, становятся все более конкретными, измеримыми и важными составляющими нашей культуры и политики.

Настанет день – и он уже недалек, – когда вы сможете вести бизнес, учиться, знакомиться с самыми разными культурами мира, организовывать отличные вечеринки, заводить друзей, посещать окрестные рынки и показывать фотографии дальним родственникам, не покидая своего рабочего места и не вставая с кресла.

Билл Гейтс, 1995 [33]

Поразительно даже не то, насколько прав оказался Билл Гейтс, а то, насколько трудно нам теперь вспомнить мир, в котором ничего этого не существовало. Цифровые средства передачи данных распространились невероятно быстро и наполнили собой нашу повседневную жизнь: мы уже с трудом можем поверить, что когда-то поездка в публичную библиотеку была единственным способом узнать, как называется столица Мозамбика, или что показать оставшимся дома друзьям наши отпускные фотографии можно было, только отпечатав дополнительную пачку фото и отправив их по почте. Как и в случае с книгопечатанием, наши методы сбора и обмена знаниями, а также организация общения снова перевернулись с ног на голову. И, как и раньше, наши коллективные эксперименты плетут новую социальную сеть, связывающую воедино тех, у кого есть привилегия доступа к технологиям. Что изменилось на этот раз – так это размах, с которым распространяется эта привилегия.

Это новый мир. И следующие две главы покажут, каким образом он меняет всех нас.

2

Новые взаимосвязи

Как все человеческие контакты стали более плотными и сложными

Что происходит, когда вы сгибаете карту, приближая друг к другу четыре ее угла? Вы меняете расположение каждой точки на поверхности карты по отношению к каждой другой точке. То, что когда-то было разбросано по краям, превращается в новые порты в сфере возможностей. Центр, некогда незыблемый, становится относительным. Расстояния, которые ранее терялись в бездне, делаются измеримыми и познаваемыми. Колумб, Магеллан, да Гама, Гутенберг – они сделали со своим миром именно это. И мы делаем то же самое со своим миром. Доказательства отнюдь не исчерпываются всепроникающим цифровым пространством. Каждый известный человечеству способ контакта, будь то торговля, финансы, коммуникации или путешествия, подтверждает, что мы теперь живем в новом мире.

Торговля

Истребление морских чудовищ

Торговля представляет собой узкий – а значит, несовершенный – канал всемирной связи, но она служит хорошим индикатором. Исторически сложилось так, что торговцы и предприятия, ищущие выгоду, стали первыми, кто рискнул проникнуть сквозь новые трещины в барьерах, разделяющих народы мира. Когда Христофор Колумб «открыл» Америку, когда Васко да Гама достиг Индии, обогнув южную оконечность Африки, когда экипаж Магеллана успешно приплыл в Азию, изначально отправившись в неверном направлении, все они преследовали одну цель – найти новые возможности для торговли, а конкретнее – найти альтернативу сухопутному пути на Восток, маршруту, который в то время контролировали османы.

До этих первооткрывательских путешествий торговля была в основном региональной, а междугородная и межконтинентальная торговля осуществлялась главным образом по суше или по внутренним морям. Европа представляла собой причудливый полуостров на обочине мира. «Европы» как континентального целого даже не существовало. Ее население состояло из разобщенных, постоянно воюющих друг с другом венецианцев, арагонцев, баварцев, флорентийцев и других народов, которые производили товары и обменивались ими между собой с почти незаметными для других регионов последствиями. Торговля с известным миром (Азия, Ближний Восток и Африка) составляла не более 2 % европейской экономики [1]. Европейцам приходилось платить за ввоз фарфора, шелка и пряностей наличными – золотом и серебром, – поскольку они не производили никаких товаров, имеющих ценность в глазах других цивилизаций.

Новые карты полностью изменили положение. Драгоценные по тогдашним меркам ресурсы мира (рабы, пряности, сахар и золото) впервые пришли в глобальное движение. Европа – этот термин постепенно стал что-то обозначать – дирижировала все более масштабными межконтинентальными потоками. В начале XVI в. работорговцы в Атлантике открыли бесчеловечный бизнес – от 10 до 15 тысяч африканцев ежегодно увозили на кораблях из родных домов в колонии в Северной и Южной Америке. Там рабы трудились на плантациях сахарного тростника, кофе и (после 1560 г.) табака, производя товары, которые потребляли европейцы по другую сторону океана [2]. Рабы также добывали в Новом Свете золото и серебро. В XVI в. Испания и Португалия извлекли из обеих Америк (особенно из Южной Америки) 150 тонн золота – столько же, сколько было добыто в этот период во всей Европе [3]. Часть золота и серебра они привезли домой, чтобы погасить долги и финансировать войны, но основная часть отправилась в Азию для покупки восточных предметов роскоши: фарфора, шелка, чая, кофе и особенно перца (который в первой половине XVI в. составлял 85 % всего торгового оборота Португалии в Индийском океане) [4].

Объемы грузов, перевозимых по океану, в первые сто лет после открытия мировых торговых путей были достаточно скромными. Португальцы ежегодно отправляли через Индийский океан в Азию всего семь торговых кораблей, каждый из которых нес от 400 до 2000 тонн предназначенных для обмена товаров, а также слитков золота. Испанцы имели более оживленные связи со своими колониями в Новом Свете – в 1520 г. они отправляли через Атлантический океан по два судна в неделю. И все же морские чудовища были истреблены, расстояния перестали пугать своей таинственностью и путешествия по просторам Мирового океана стали обычным, хотя по-прежнему опасным делом. Морская торговля протянула нити между континентами, культурами, ресурсами и языками, кроме того, появились международные финансовые и крупномасштабные кредитные предприятия, позволявшие финансировать коммерческие экспедиции во все более отдаленные регионы. Экономический центр мира переместился с Ближнего Востока, который со времен Древнего Вавилона был главным перекрестком человеческих дорог, в Европу. «Открытие Америки и пути в Ост-Индию вокруг мыса Доброй Надежды стали двумя крупнейшими и наиболее важными событиями, случившимися в истории человечества», – заметил Адам Смит около трехсот лет спустя в своем сочинении «Исследование о природе и причинах богатства народов» (An Inquiry into the Nature and Causes of the Wealth of Nations, 1776).

На суше стена между Западом и Востоком тоже оказалась не такой неприступной, как заставлял думать призрак кровожадного турка. Новое соседство двух цивилизаций, ни одна из которых не имела возможности завоевать другую, вынудило обе стороны налаживать более сложные коммерческие, дипломатические и культурные отношения. Генуэзцы утратили доступ к Черному морю, венецианцы потеряли острова и порты Эгейского моря и Восточного Средиземноморья, но рыночный спрос на товары, которые приходили по этим маршрутам, не исчез. Предприимчивые торговые компании, дипломаты и адвокаты совместно работали над инновациями в банковском деле, кредитовании, бухгалтерском учете и системах обмена валют, чтобы сохранить дороги Великого шелкового пути открытыми для бизнеса. В то же время в 1517 г. османы завоевали Египет (который имел выход к Индийскому океану через Персидский залив) и тоже начали развивать морскую торговлю с Азией [5].


Слом барьеров

В наши дни драгоценные ресурсы некогда изолированных земель снова введены в глобальный оборот.

Барьеры, отделявшие «нас» от «них» в эпоху холодной войны, привели к тому, что глобальный экспорт товаров (выраженный в виде доли мирового валового внутреннего продукта, ВВП) в 1973 г. был не выше, чем в 1913 г., перед началом Первой мировой войны, и составлял 12 % [6]. И это несмотря на множество крупных новых стимулов для развития международной торговли, появившихся за эти 60 лет, – среди них изобретение широкофюзеляжных пассажирских и грузовых самолетов, развитие коммерческой авиации и интермодальных морских контейнерных перевозок, появление массовой внутренней и международной телефонии, принятие международного золотого стандарта для устранения валютного риска в процессе движения международных денежных потоков и деятельности транснациональных корпораций.

После того как барьеры были разрушены, поток товаров превратился в водопад – он стал намного больше по объему и разнообразнее, чем в предыдущие полвека, и взаимно укреплял новые рынки и производственные центры, присоединявшиеся к глобальной экономике.


Новые объемы

Мировой товарообмен как доля от общей экономической деятельности на протяжении 1980-х гг. оставался низким. И вдруг он начал расти. В 1990 г. мировая торговля составила одну седьмую мирового ВВП. В 2014 г. она составляла уже четвертую часть. Один из каждых четырех долларов, заработанных во всем мире, в настоящее время поступает от продажи товаров в другие страны. И стоимость этих товаров возросла более чем на 500 %, от 3,5 триллиона долларов в 1990 г. до 19 триллионов долларов в 2014 г., несмотря на глобальную рецессию, вызванную мировым финансовым кризисом 2008 г. [7].

Торговля услугами исторически была намного менее оживленной (экспортировать стрижки намного сложнее, чем «харлей-дэвидсоны»), но и здесь объемы резко возросли. Международные потоки услуг удвоились в относительном выражении с 1990 г. от 3 % до >6 % мирового ВВП и увеличились вшестеро в стоимостном выражении, с 0,8 триллиона долларов до 4,7 триллиона долларов [8].


Новое разнообразие

Помимо объемов выросло и разнообразие мировых торговых связей.

Прежде всего это географическое разнообразие. В 1990 г. бо́льшая часть торговли осуществлялась между развитыми странами. Целых 60 % глобального обмена товарами составлял взаимный экспорт из одних богатых стран в другие. На долю торговли между развивающимися странами приходилось лишь 6 %. Но теперь эти доли почти сравнялись. Объем торговли повсеместно возрос, причем вдоль новых торговых путей, открывшихся между странами с формирующимся рынком, он вырос в два раза быстрее.

Изменение баланса отражают и рейтинги мировых контейнерных портов. В 1990 г. все 10 ведущих портов мира с максимальным годовым оборотом находились в развитых странах. В 2014 г. 14 из ведущих 25 портов находились в развивающихся странах, при этом одному только Китаю принадлежали 7 портов из первой десятки. Шанхай, начиная с 2011 г. самый оживленный в мире контейнерный порт, не входил в число первых двадцати пяти до 1990 г. [9].

Товары, участвующие в мировом обороте, также стали более разнообразными. Крупнейшую долю глобальной торговли, как и прежде, составляют нефть, газ, кофе, пшеница, железо и другие необработанные ресурсы. Но в сфере обмена промышленными товарами сейчас наблюдается большее разнообразие, чем всего лишь четверть века назад. Заметка из журнала Международной организации гражданской авиации за июль 1991 г. сообщает о прибытии первого «Боинга-747» китайской компании Air China, который «используется для транспортировки текстильных изделий, одежды и прочих грузов из Пекина в Лос-Анджелес, Сан-Франциско, Лондон, Париж и Гонконг. На обратном пути коммерческий груз воздушного судна составят компьютеры и другие электронные устройства» [10].

Сегодня мы оглядываемся на эти зарисовки с насмешливым недоверием. Простой меркантилистский подход, с которым развитые страны когда-то подходили к странам развивающимся, извлекая выгоду из их дешевой рабочей силы и богатых ресурсов, ныне устарел. Страны с развивающейся экономикой уже не просто поставляют ресурсы и предоставляют рынки сбыта – их выращенные в домашних условиях чемпионы могут выдерживать на мировом рынке конкурентную борьбу за капитал, за клиентов и за таланты.

В 2012 г. Китай обогнал Соединенные Штаты, став крупнейшим в мире производителем. Бразилия, Индия, Индонезия, Мексика и Россия находятся в числе ведущих пятнадцати производителей [11]. За последнюю четверть прошлого века Вьетнам отказался от централизованного планирования в сельском хозяйстве и превратился из импортера риса в одного из крупнейших мировых экспортеров, Бангладеш построил с нуля экспортоориентированную швейную промышленность с оборотом 1,5 миллиарда долларов [12], владельцы мелких молочных ферм Новой Зеландии консолидировались и вытеснили Евросоюз с позиции крупнейшего в мире экспортера молочной продукции, занимающего одну треть общего рынка [13], Индия создала экспортоориентированную IT-индустрию с оборотом 100 миллиардов долларов [14], в настоящее время выполняющую 70 % всего отданного на аутсорсинг анализа данных и маркетинговых исследований в мире [15], и этот список можно еще продолжать.

Китай, конечно, представляет собой отдельный выдающийся случай. Тридцать лет назад находившийся почти в полной изоляции, в настоящее время Китай торгует более чем с 230 странами и регионами, больше, чем любая другая страна в мире. Его доля в мировом экспорте выросла в шесть раз по сравнению с 1990 г. – с 2 до 12 % от общемировых показателей, то есть снова больше, чем у любой другой страны [16]. Долларовая стоимость экспорта выросла почти в 40 раз, от всего 62 миллиардов долларов до >2,3 триллиона долларов в 2014 г. [17]. Структура изменилась с легкой промышленности (одежда, обувь, текстиль и мебель) на производство дорогостоящей техники и электроники. И экспорт – это только половина истории. Импорт в Китае сохраняет темпы роста от 20 миллиардов долларов в 1980 г. до 2 триллионов долларов в 2014 г., причем основные статьи импорта составляет современное производственное оборудование и оборудование для получения электроэнергии, а также энергия и сырье [18]. Китай – единственный крупный заказчик для всех крупных стран в своем регионе (Япония, Австралия, Южная Корея и Тайвань), а также для крупнейших стран Латинской Америки и Африки (Бразилия и Нигерия). В настоящее время Китай единолично обеспечивает около трети общего объема торговли в развивающихся странах [19].


Международные торговые потоки

Эпоха открытий

Торговля стала по-настоящему глобальным феноменом

Rahul C. Basole and Hyunwoo Park, для Pankaj Ghemawat and Steven A. Altman (2014). Индекс мировых связей DHL в 2014 г. По материалам www.dhl.com/gci плюс примечания авторов


Каналы снабжения быстро адаптировались к новым возможностям и опасностям. В 1992 г. Nokia осуществила первый в мире серийный выпуск мобильного телефона Nokia 1011. Его собирали в основном в Великобритании и Финляндии (недалеко от европейских потребителей) из компонентов, сделанных в Южной Корее. Сравните это с сегодняшним Apple iPhone – более 700 поставщиков разбросаны по тридцати с лишним странам на пяти континентах [20]. Усложнение логистики отчасти объясняется повышением сложности самих продуктов (в модели Nokia 1011 не было камеры, не говоря уже о сенсорном экране), но связано еще и с тем, что у развивающихся стран появилось больше возможностей производить и покупать передовую продукцию, а также с ростом коммуникаций и транспортных технологий, которые позволяют объединить в одну цепочку множество разных стран и сопоставить разнообразные позиции спроса и предложения. В 1990-е и 2000-е гг. мы называли такую практику «офшорингом»: в основном это означало, что требующие ручного труда и повторяющиеся звенья производственно-сбытовой цепочки (например, сборка и помощь клиентам) перепоручались тем странам, где данная работа стоила дешево. В настоящее время этот термин устарел – он подразумевает деление на «своих» и «чужих», от которого руководству компаний придется избавиться, если они хотят продолжать конкурировать на сегодняшних рынках. Сегодня продукция «сделана в мире» – а некоторые продукты, например iPhone, также и покупаются во всем мире. Бизнес разрывает производственно-сбытовую цепочку и стратегически размещает каждое ее звено: что-то уходит в офшор, что-то, наоборот, возвращается в местное и соседское производство. Стоимость имеет значение, однако не она диктует окончательное решение. В XXI в. производить компоненты для американских автомобилей в Теннесси может быть так же выгодно, как в Гуанчжоу, если при этом учтены время, накладные расходы, риск и оперативность.

Финансы

От Венеции до Антверпена

Новые карты и новые средства массовой информации преобразовали финансовые связи. Благодаря своей важной роли в обществе финансы всегда служат наглядным доказательством социальных перемен. Мы не всегда осознаем эту роль, поскольку «финансы» принадлежат к числу понятий, которые используют так часто, что их смысл постепенно размывается, и нам бывает непросто разобраться, что же оно означает на самом деле.

Но если отбросить заоблачные бонусы и подпирающие облака небоскребы, останется отрасль, исполняющая основную важную функцию в экономике: говоря просто, ее задача – направлять свободные денежные средства к тем видам деятельности, которые в них нуждаются, чтобы эта деятельность могла осуществиться. Это тот аспект финансов, который действительно имеет значение. В эпоху предыдущего Ренессанса эта функция претерпела два существенных изменения, с обоими из которых мы уже знакомы: география привлечения инвестиций расширилась от локального венецианского предприятия до рыночной деятельности континентального размаха с центром в Антверпене, а участниками этого рынка, помимо купцов и коммерсантов, стали практически все, от князей до крестьян. Совместно эти изменения нарастили объем финансовых потоков и связали воедино судьбы всего Европейского континента [21].

С конца XV в. экономический центр Европы переместился от Средиземного моря к Атлантическому океану, и вместе с ним переехали итальянские банковские дома и банковские методы. Отчасти это произошло потому, что жизнь толкала итальянцев в новые центры роста: Медичи, например, перенесли свою основную ветвь из Флоренции в Антверпен. Кроме того, это было вызвано тем, что формирующиеся торговые компании в Германии и Нидерландах перетянули к себе итальянский опыт и применили его в собственной практике бухгалтерского учета, заключения контрактов и управления финансами.

С расширением пришли новшества – и изменение правил. Основным финансовым инструментом итальянцев был коммерческий вексель – по существу, долговая расписка, составленная между покупателем и продавцом материальных товаров. Итальянский покупатель перца в 1450 г. не расплачивался на месте со средиземноморским поставщиком. Вместо этого он давал ему долговую расписку и выплачивал долг только после того, как перевозил перец и перепродавал его континентальным покупателям. Расписки были вполне удобной формой кредита с одним существенным ограничением: их нельзя было передавать третьим лицам. Итальянцы рассматривали их как частное обещание, заключенное между двумя людьми, которые достаточно доверяют друг другу, чтобы вести бизнес в безналичной форме.

Но в прибрежном Антверпене, новой столице европейской торговли в XVI в., это ограничение скорее мешало торговцам. Перец из Индии, серебро из Нового Света, ткани из Англии и металлы из Германии – все проходило через этот портовый город. Покупатели и продавцы разъезжали по всей Европе, в каждый момент времени они были должны кому-то и им тоже кто-то был должен, число долговых расписок исчислялось дюжинами, а иногда сотнями, и каждая из них была уникальной, с уникальным сроком погашения. Чтобы торговля могла беспрепятственно продолжаться, им всем нужен был более гибкий кредитный инструмент, который помог бы точнее определять активы и пассивы. Поэтому примерно в 1520 г. они согласились считать коммерческий вексель передаваемым. (Трудность заключалась в реформировании правовой системы таким образом, чтобы риск невозврата кредита также стал передаваемым [22].)

Очень быстро возникла «международная республика денег», общая стоимость которой во много сотен раз превосходила стоимость товаров, которые она финансировала [23]. Теперь вместо того чтобы торговаться с местными покупателями и поставщиками, предприниматель мог собрать деньги, необходимые для оплаты своей следующей экспедиции за индийским перцем, продавая долговые расписки (векселя) на фондовой бирже Антверпена. Изумительная ликвидность публичных рынков капитала давала купцу простой способ собрать деньги, хеджировать риски и определить текущую рыночную стоимость своего товара. Расписки, которые он продавал, могли сменить множество рук еще до того, как его корабли бросали якорь в порту назначения: двадцать раз было вполне распространенным числом, и в сотне тоже не было ничего необычного. Иногда продавцами расписок двигало стремление получить прибыль или сократить убытки (цены на перец были печально известны своей неустойчивостью); иногда держателю векселя требовалось срочно получить наличные для тех или иных целей. Расписки, выданные наиболее зарекомендовавшими себя торговыми предприятиями (например, купеческим домом Фуггеров), переходили из рук в руки почти как сегодняшняя бумажная валюта [24].

Результатом всей этой новой рыночной деятельности было более широкое участие и континентальная интеграция в области финансов. На фондовой бирже в Антверпене было представлено около 5000 продавцов из всех европейских стран. «Там можно было услышать смутный гул всех существующих языков и увидеть пеструю мешанину всевозможных одежд – одним словом, антверпенская биржа казалась небольшим мирком, в котором объединились все части большого мира», – рассказывал один из купцов [25].

Отдельным индивидуумам больше не приходилось заниматься непосредственной торговлей, чтобы получить выгоду. Любой, кому понравились предложенные условия и репутация продавца, мог поучаствовать в торговле векселями. Неторговые организации, доверенные лица и мелкие инвесторы – все они стали активными краткосрочными игроками. С постоянно растущим количеством игроков совокупность наличного капитала увеличивалась, и постоянно росло число торговых предприятий, получавших возможность начать свою деятельность. Другие предприятия тоже участвовали в биржевых операциях. Муниципальные власти от Кале до Осло закладывали на бирже государственную аренду и земли, чтобы получить крупные суммы для развития сельского хозяйства, жилой сферы, горнодобывающих и транспортных проектов.

Фондовые биржи также помогли интегрировать физические рынки Европы. По мере того как рынки капитала снижали затраты и риски, связанные с финансированием торговли, транспортные расходы и задержки постепенно теряли свое значение. Вскоре испанские и португальские пекари обнаружили, что пшеница, выращенная в Северной Балтике, может стоить дешевле, чем местное зерно. Точно так же французская и португальская соль начала прокладывать себе путь на внутренние рынки балтийских производителей.

Новый финансовый рынок соединил экономические судьбы континента. В главе 6 мы расскажем о том, какие новые опасности это повлекло за собой и вместе с тем как это помогло людям активнее пользоваться возможностями, которые открывала та эпоха.


От Уолл-стрит до Дубая

Более глубокая интеграция, расширение числа участников, резкое увеличение масштабов и рисков – во многих смыслах это также и история современных финансов.

Каким образом мы дошли до того, что лопнувший в 2007 г. пузырь на американском рынке недвижимости спровоцировал глобальный экономический кризис? В 1990 г. сборами инвестиций и их вложением за рубежом занимался в основном клуб богатых стран. Центрами международной финансовой деятельности были США и Западная Европа. Еще в 1999 г. США выступали партнером в 50 %, в стоимостном выражении, всех международных сделок [26]; 0,9 всех денежных потоков, преодолевающих государственные границы, принадлежали развитым странам [27]. Направленные вовне и внутрь денежные потоки в странах с развивающимся рынком были незначительны. У развитых стран было мало информации о возможностях развивающихся рынков, развивающиеся рынки, в свою очередь, имели бедную инфраструктуру и недостаточно опыта для улучшения ситуации.

В эпоху предыдущего Ренессанса толкавшие и тянувшие прогресс факторы способствовали распространению итальянских кредитных практик на всем Европейском континенте. Начиная с 1990 г. похожие стимулы распространились на рынке капитала в большей части планеты. Наиболее очевидным фактором, притянувшим капиталы развитых стран на развивающиеся рынки, снова стал пространственный сдвиг центра экономического роста. По мере возникновения стагнации в развитых странах инвесторы начали обращать все больше внимания на жаждущую инвестиций экономику быстро развивающихся стран. За несколько лет эти страны провели крупные реформы, сделавшие их более привлекательными для иностранных капиталовложений. Открыв свою экономику для международной торговли, они также пригласили международных кредиторов и инвестиционных банкиров делать ставки в их экономической игре, приняли более привычную фискальную и монетарную политику, упростили процедуру ввода и вывода денежных средств через границу и выставили ценные государственные активы на продажу для частных инвесторов. Одновременно с этим в странах с развитой экономикой происходило снижение процентных ставок и ослабевал экономический рост, и это вытолкнуло инвесторов из привычной зоны комфорта.

Распространение снова сопровождалось финансовыми инновациями, в результате которых произошел внезапный скачок в масштабе рыночной активности. Главные новшества – секьюритизация и кредитные деривативы – точно так же были направлены на то, чтобы долги и риски стало легче передавать. С помощью секьюритизации кредитор смешивает различные долговые расписки, держателем которых является (говоря современным языком, это облигации и ипотечные кредиты). Специалисты по биржевому анализу – выпускники физических и математических факультетов, которые в прежние годы, возможно, ушли бы вместо этого в ракетостроение, – тщательно изучают эту смесь, чтобы уменьшить общий риск, сохраняя при этом огромные возвраты. Кредитор затем небольшими порциями перепродает полученный коктейль другим инвесторам. Таким образом он списывает долги из бухгалтерских книг и снова может выдавать кредиты. Кредитные деривативы возникли как своего рода страховой полис, купленный кредитором на случай, если некоторые наименее надежные долговые расписки, находящиеся в его руках, так и не будут погашены. Он покупает кредитные деривативы у третьих лиц, желающих взять на себя этот риск (за отдельную плату); если заемщик в конечном счете не исполнит долговых обязательств, покрывать убытки кредитора будет третья сторона. Снимая с себя этот риск, кредитор точно так же получает возможность кредитовать снова.

Одним из важных последствий этих двух новшеств стало появление в середине 1990-х гг. ипотечного рынка. До середины 1990-х гг. заемщик оценивался либо как «стандартный» (prime), то есть получал кредит под действующую процентную ставку, либо «субстандартный», или «высокорисковый» (subprime), что, как правило, означало, что он вообще не получал кредита. В середине 1990-х гг. кредиторы, вооруженные новыми финансовыми инструментами, позволявшими переписывать долги и риски (а также более дешевыми и мощными компьютерами, дававшими возможность вести точный учет), начали предлагать «субстандартным» заемщикам кредиты под высокие проценты. Выдача «субстандартных» кредитов выросла с 65 миллиардов долларов в 1995 г. до 332 миллиардов долларов в 2003 г. [28].

Свою роль также сыграло изменение правил. В 1986 г. реформы, предпринятые Маргарет Тэтчер в Великобритании, ликвидировали фиксированные торговые комиссии и ввели электронные торги. В следующем десятилетии Европейский экономический и валютный союз еще больше облегчил и упростил процесс передвижения капитала по всей Европе. В 1996 г. Федеральная резервная система США позволила финансовым учреждениям использовать кредитные деривативы, чтобы снизить для них нормы обязательных резервов (опять же для того, чтобы они могли выдавать больше кредитов). В 1999 г. принятый США закон о модернизации финансовых услуг отменил действие Закона Гласса – Стиголла 1933 г. и позволил банкам, фирмам, ведущим операции с ценными бумагами, и страховым компаниям конкурировать между собой в соседних отраслях.


Новые объемы

Внезапно межгосударственные финансовые потоки резко увеличились. С 1990 по 2007 г. глобальные межгосударственные потоки выросли примерно от 1 триллиона до 12 триллионов долларов в год – то есть ежегодный скачок роста составлял в среднем 16 %, и это продолжалось почти двадцать лет подряд [29]. Финансовый кризис 2007–2008 гг. заметно ослабил эту деятельность (в основном среди стран с развитой экономикой), но около 4,5 триллиона долларов долгов и собственного капитала по-прежнему ежегодно пересекают границы [30].


Новое разнообразие

Финансовые потоки не только стали гораздо мощнее, они также охватывают намного более обширную территорию, чем 25 лет назад.


Международные потоки инвестиций

Эпоха открытий

Межгосударственные финансовые потоки складываются во всемирный бухгалтерский баланс

Rahul C. Basole and Hyunwoo Park, для Pankaj Ghemawat and Steven A. Altman (2014). Мировой индекс связей DHL в 2014 г. По материалам www.dhl.com/gci плюс примечания авторов


Западная Европа выстроила прочные связи с развивающимися рынками – Африкой, Ближним Востоком, Россией и Восточной Европой, а также некоторыми регионами Азии. Прочные новые связи были налажены непосредственно между странами с формирующейся рыночной экономикой. Латинская Америка в настоящее время имеет инвестиционные связи с развивающейся Азией, которые так же важны, как и ее связи с Западной Европой. Объем прямых иностранных инвестиций (ПИИ) в развивающиеся страны возрос с < 1/5 почти до 3/5 общемировых ПИИ начиная с 1990 г. [31]. (ПИИ имеют значение, поскольку они обычно предоставляются на длительный срок и формируют между кредитором и получателем канал связи, по которому может осуществляться обмен технологиями и навыками управления.) И, хотя движение долгов, собственного капитала и других форм инвестиций в развитых странах остается вялым, финансовые потоки, направленные в Китай, Южную Азию, Латинскую Америку и Африку, уже вернулись к своей докризисной мощности.

Мировой капитал был объединен в более крупную, сложную и глобальную сеть инвестиций.

Чтобы стать свидетелем этой новой глобальной интеграции финансов, необязательно держать перед собой карту мира. Вы можете наблюдать этот процесс в своем личном кредитном портфолио – или могли бы, если бы отчетность финансовых учреждений была более прозрачной. Ваша пенсия (в США ваш 401(k) может оказаться вложена в ветряные электростанции в Йоркшире, золотой прииск в Монголии, недвижимость в Рио – или во все три этих предприятия сразу. Ипотечный кредит, который вы взяли несколько лет назад, сегодня вполне может принадлежать компании на Каймановых островах. Ваши ежемесячные выплаты задолженности по кредитной карте, студенческий кредит и автокредит могут быть переданы держателям облигаций в Лондоне, Дубае, Токио, Йоханнесбурге или любом другом месте.

Размах и сложность наших финансовых взаимосвязей порождает новые риски (такие как финансовый кризис – см. главу 6), но вместе с тем приносят новые возможности. По всей планете проекты, нуждающиеся в деньгах, с большой долей вероятности их получат. Согласно оценкам, более 700 стремительно развивающихся городов в развивающихся странах потребуют 40 триллионов долларов для создания к 2030 г. новых объектов инфраструктуры – дорог, портов, электростанций, сетей водоснабжения и телекоммуникации, школ, больниц и т. п. [32]. Мало кто сможет покрыть эти расходы самостоятельно и авансом. При этом помощь идет в обоих направлениях. В обобщенном смысле именно развивающиеся страны служили экспортерами капитала в развитые страны мира в 2015 г. [33]. Это хорошая новость для развитой страны, например такой как Канада, щедро наделенной природными ресурсами, но с небольшим населением. К 2020 г. Канада собирается инвестировать около 650 миллиардов долларов только в развитие своего энергетического сектора [34]; вряд ли ей удастся найти столько свободных денежных средств у своих 35 миллионов граждан.

Финансовая отрасль связана с риском, и ее главные действующие лица довольно часто теряют из виду свою реальную роль в обществе, но сейчас она, как никогда, способна поддерживать прогресс человечества.


Подводя итог всему вышесказанному, торговля теперь в два раза важнее для мировой экономики, чем 25 лет назад. Совокупная стоимость ежегодного международного потока товаров, услуг и денег поднялась с >20 % мирового ВВП в 1990 г. почти до 40 % в настоящее время (в денежном выражении – с 5 триллионов долларов почти до 30 триллионов долларов в год). И доля развивающихся стран в этом показателе увеличилась в три раза [35]. Экономические ресурсы мира снова были приведены в глобальное движение.

Люди

А что же происходит с самым ценным мировым ресурсом – людьми? Когда карты мира меняются, между людьми возникают новые отношения. Старые границы становятся новыми дорогами. Зрители превращаются в участников. Человечеству с незапамятных времен была свойственна тяга к путешествиям, и, когда мир открывается, поток людей – то есть нас – это наглядно демонстрирует.


Короткие путешествия

Люди, имевшие достаточно талантов или средств для путешествий в эпоху предыдущего Ренессанса, неожиданно обнаружили, что на свете есть множество новых мест, которые обязательно нужно посетить. К уже известным деловым центрам (Венеция, Париж), учебным центрам (Падуя, Болонья) и культурным центрам (Флоренция) добавились Антверпен (торговля и промышленность), а также города, из которых открывался путь в Атлантику и в Азию: Лиссабон, Севилья, Амстердам и (позже, в 1600 г.) Лондон. Католическая церковь воскресила Рим, долгое время пребывавший в полузабвении, и теперь все дороги снова вели к нему. Венеция, приморский посредник между европейскими и восточными торговцами, стала еще более многонациональной, чем раньше. Там христиане и евреи со всех концов Европы и Леванта ежедневно встречались друг с другом, с турками-османами и некоторым количеством странствующих и оседлых торговцев из Африки и с Дальнего Востока. Сложная демография города отразилась в его архитектуре, представлявшей собой необычное смешение византийского, мусульманского и итальянского стилей.

Города-перекрестки отличались культурным разнообразием, постоянным притоком новых людей, товаров и идей. Эти три условия – разнообразие, толпы народа и перемены – объединялись в одно целое в портах, на рынках, в церквях, при дворе, в домах богачей и в университетах (где общение было упрощено использованием общего для того времени академического языка – латыни). К началу XVI в. более 40 % студентов знаменитого Ягеллонского университета в Кракове были иностранцами, прибывавшими порой из таких далеких земель, как Скандинавия и Шотландия; Падуанский университет в Италии ежегодно заканчивали сотни немцев. Паломничество в эти города стало обязательным для элиты XVI в., оно позволяло приобрести новые знания, умения и связи, необходимые для достижения успеха в быстро меняющемся мире, найти протекцию для профессионального развития или рискованного предприятия и изучать языки, в первую очередь греческий, а также арабский и иврит, чтобы иметь возможность участвовать в самых интеллектуальных диспутах своего времени.

Сегодня на перекрестках снова кипит жизнь. Нью-Йорк, Лондон, Токио, Париж, Сингапур, Лос-Анджелес, Брюссель, Пекин, Сан-Паулу – попробуйте найти мирового лидера в какой-либо отрасли, из любой страны, который не посетил хотя бы один из этих городов. У вас ничего не выйдет. Другие следуют по их стопам. С 1990 по 2014 г. общее количество международных туристических поездок во всем мире (поездка определяется как выезд в другую страну по крайней мере на одни сутки) выросло с 440 миллионов до 1,4 миллиарда, а крупнейшим источником путешественников в настоящее время является Китай [36]. Не менее наглядную картину дает статистика воздушного трафика. Общее количество пассажирских поездок резко поднялось с 500 миллионов в 1990 г. до >3,2 миллиарда в 2014 г. [37]. А с 2011 г. число международных перелетов превосходит число внутренних перелетов [38].

Множество факторов способствовали этому росту. Одним из них стало появление в Северной Америке, Европе и Азии авиакомпаний, осуществляющих низкобюджетные пассажирские перевозки (Southwest Airlines, EasyJet, RyanAir, Peach и др.), что значительно увеличило количество воздушных путешественников. Но еще более важную роль сыграло возникновение на бывших окраинах мира новых центров притяжения, подключившее большие группы населения к глобальной ротации джетсеттеров – завсегдатаев модных курортов.

Их появление наглядно отражено в рейтинге самых оживленных аэропортов мира. В 1990 г. только два из двадцати пяти главных аэропортов мира (их определяют по общему количеству пассажиров в год) находились за пределами Северной Америки, и это были крупные европейские центры: лондонский Хитроу и аэропорт Франкфурта. Сегодня их уже шестнадцать – и второе место среди них занимает аэропорт Пекина [39]. Перемены также прослеживаются в уменьшении роли двадцати пяти главных аэропортов. Еще в 1990 г. они обеспечивали более 50 % мирового трафика. На сегодняшний день они обеспечивают меньше четверти, поскольку появилось множество новых маршрутов и узловых пунктов, через которые проходят крупные потоки пассажиров, особенно в Китае, где воздушный трафик увеличился в 20 раз [40].

Двадцать лет назад три четверти воздушных путешественников отправлялись в дорогу из Северной Америки и Европы. Сегодня туристы из Северной Америки, Европы и Азии составляют по одной четверти от общего мирового количества воздушных путешественников. Термин «джетсет» по-прежнему связан с деятельностью ограниченной элитной группы, но в течение ближайших 20 лет к этому клубу должны присоединиться миллиарды людей. По расчетам крупных авиапроизводителей Boeing и Airbus, в период с 2015 до 2034 г. быстрее всего число авиапассажиров будет расти в Африке (хотя она начинает с очень низкой отметки), затем в Латинской Америке, Азии и на Ближнем Востоке. Связи между Африкой и Латинской Америкой окажутся среди самых быстро растущих межрегиональных маршрутов. В конкретных цифрах азиатский пассажирский поток скоро будет доминировать в залах ожидания. Если предсказания авиапроизводителей сбудутся, в 2034 г. азиатский пассажиропоток превысит североамериканский и европейский вместе взятые [41].


Долгосрочная миграция

Долгосрочные путешественники, или мигранты, – это исключительные люди. Мигрировать – значит преодолеть географические, культурные и социально-экономические расстояния, которые отделяют нас от других. Последствия подобного шага для самих мигрантов, а также для того общества, из которого они вышли, и того, к которому присоединились, крайне глубоки. Их путешествие, будь то из деревни в город (урбанизация) или из одной страны в другую, часто представляет собой героическую историю мужества перед лицом суровых обстоятельств.

Предыдущий Ренессанс стал свидетелем заметного роста миграционных потоков – то же можно сказать и о Новом Ренессансе.


Урбанизация

В доколумбовом мире в среднем лишь около 10 % населения Европы жили в городах с численностью от пяти тысяч человек (причем этот показатель сильно различался в зависимости от страны). Торговые государства, такие как Италия, занимали в списке урбанизации первые строчки (15–16 %), страны, находившиеся на окраинах Европы (Испания, Португалия, Британские острова), демонстрировали лишь скромные однозначные показатели [42]. Но с появлением новых карт окраины стали дорогами, и окраинные города быстро приспособились к переменам. В течение ста лет доля городского населения Португалии увеличилась в пять раз – с 3 до 14 % [43]. Урбанизация в Британии выросла в два раза (с 2 до 4 %), то же самое произошло в Испании (с 6 до 11 %). Население Севильи, ставшей испанским центром международной торговли с Новым Светом, составлявшее в 1500 г. около 60–70 тысяч человек, в 1588 г. выросло до 150 тысяч человек. Десятки тысяч человек проходили через города на пути в обе Америки [44]. Приток новых жителей в уже существующие центры также заметно увеличился. Города предлагали более надежные доходы, защиту городских укреплений (конфликты, подобные Итальянским войнам 1494–1559 гг., лучше было пережидать за крепкими стенами) и более богатую социальную и интеллектуальную жизнь, чем могли дать сельские поселения. Но самое главное, переезд в город – особенно торговый город – был шагом навстречу знаниям, рынкам и возможностям. В 1500 г. только пять европейских городов могли похвастаться населением свыше 100 тысяч человек, в 1600 г. таких городов была уже дюжина.

Еще в 1990 г. все наиболее урбанизированные страны принадлежали к развитому миру. Примерно три четверти населения Северной Америки и Океании, а также 70 % населения Европы, Латинской Америки и стран Карибского бассейна жили в городах. Но в Азии и Африке, на окраинах мировой экономики, город могли назвать своим домом меньшинство жителей (30 %).

Сегодня эти континенты уже не окраины, и более половины азиатов и 40 % африканцев живут в городах. В конкретных цифрах за последние 25 лет их городское население удвоилось. Иными словами, в Азии и Африке нынешнее поколение в одиночку удвоило показатели, достигнутые за предыдущие пять тысяч лет роста городского населения [45].

В результате в 2008 г. человечество в целом спокойно прошло важный этап: впервые в истории нашего вида большинство из нас живет в городах. И, если не произойдет никаких катаклизмов, мы никогда больше не окажемся по ту сторону порога. Теперь мы городские животные, и, хотя характеристики наших мест обитания различаются, в глобальном масштабе весь будущий рост населения будет происходить в городах. К 2050 г. численность городского населения может вырасти еще на 2,5 миллиарда человек, а сельское население сократится на 150 миллионов [46]. Город стал центром событий, и мы как биологический вид стремимся быть в этом центре.

Появляются новые перекрестки. Мегаполисы – Токио, Нью-Йорк, Лондон, Торонто, Париж, Нью-Дели, Сан-Паулу, Мумбаи, Мехико, Шанхай и Дакка – не сходят с мировых заголовков, но настоящая история, по крайней мере та ее часть, которая касается роста городов, будет разыгрываться в >700 развивающихся городах мира, население которых на сегодняшний день превышает 500 тысяч человек, и >350 новых городах, которые достигнут этого порога в 2030 г. Для сравнения, в них к 2030 г. появится 1,3 миллиарда жителей, а в уже существующих больших городах рост составит всего 100 миллионов жителей [47].

Мы крайне смутно представляем себе эти новые перекрестки. В их число входит около 150 региональных центров с населением 5–10 миллионов жителей, таких как Чанша в Китае, Жоинвили в Бразилии и Веракрус в Мексике, несколько сотен растущих городов среднего размера, с населением от 1 до 5 миллионов, таких как Ахмадабад в Индии и Сочи в России (часто они складываются вокруг местных природных ресурсов или промышленных предприятий), а также тысячи мелких, бурно развивающихся городков, которые мало кто из нас сможет найти на карте, таких как Хэншань, Лэйбо, Кучаман-Сити, Конч, Кашиас, Тимона, Эскобедо и Абасоло.

Китай лидирует в истории урбанизации. В 1982–1986 гг. в результате отказа от государственного планирования в сельском хозяйстве в стране появилось множество незанятых сельских работников. За четыре коротких и беспокойных года городское население Китая выросло с 200 миллионов почти до 400 миллионов человек [48]. Следующий городской бум в Китае начался после того, как в 1992 г. Дэн Сяопин совершил свое историческое южное турне, посетив прибрежные провинции юго-востока Китая (в ходе которого он, по некоторым сведениям, заявил: «Разбогатеть – значит прославиться»), утвердил рыночные реформы как часть учения Китайской коммунистической партии и задал курс на экспортоориентированное расширение, перетянувшее сельских работников на побережье. Шэньчжэнь в дельте Жемчужной реки стал современной Севильей. В 1970-х гг. это был рыбацкий поселок с населением 10 тысяч человек, но в 1979 г. он был объявлен особой экономической зоной, и в следующие десять лет численность его населения достигла 2,5 миллиона человек. После южного турне рост вышел на новую стадию: в 2000 г. население Шэньчжэня превысило 8 миллионов человек, а в 2015 г. оно составляло 10 миллионов (или 15 миллионов, считая трудовых мигрантов) [49]. Та же история повторилась в десятках других мест, и сегодня более половины населения Китая – почти 800 миллионов человек – живет в городах [50]. За одно десятилетие в города переселилось почти полтора миллиарда человек – столько же, сколько жителей во всех странах Евросоюза.

Следующую главу в истории роста населения и урбанизации напишет Африка. С настоящего момента и до 2030 г. именно в Африке, а не в Китае будет происходить самый масштабный и быстрый в мире рост городов. В то время как общая численность населения Китая будет оставаться на прежнем уровне – около 1,3–1,4 миллиарда человек, – население Африки, согласно ожиданиям, увеличится с нынешнего 1 миллиарда человек до >1,6 миллиарда. этих новичков будут рождаться в городах, увеличив долю городского населения Африки до 50 % к 2030 г. Численность жителей Каира, сегодня самого густонаселенного города Африки, возрастет с 18 до 24 миллионов человек. Но к тому времени его могут обогнать Лагос или Киншаса (оба держат темп роста, позволяющий удвоить нынешнюю 12-миллионную численность населения) [51].


Урбанизация приносит множество преимуществ. Она приближает людей друг к другу, и это повышает эффективность использования земель, энергии, воды и других ресурсов нашего мира. Она увеличивает плотность наших контактов и общественных отношений, развивает материальную и цифровую инфраструктуру, соединяющую нас по всему миру. Человеческие ресурсы концентрируются в городах. Финансы, производство, рынки, таланты, информация и знания – все это легче находить и накапливать в городах. В части II мы продемонстрируем, какие положительные последствия для прогресса человечества может иметь урбанизация при благоприятных условиях. Часть III покажет, что этот процесс заключает в себе и новые опасности.


Пересечение границ

Предыдущий Ренессанс был временем массового, и в основном вынужденного, перемещения людей из одних стран в другие.

Эта циркуляция началась еще в Европе. На востоке завоевание турками Константинополя вынудило тысячи греков бежать в итальянские города – Венецию, Флоренцию и Рим. На западе в 1492 г. католические монархи Фердинанд и Изабелла подчинили себе остатки некогда великой мусульманской территории Аль-Андалус. Мусульмане из Северной Африки с 711 г. занимали бо́льшую часть территории современной Испании и Португалии – теперь они стали нежеланными гостями в своем бывшем доме. Фердинанд и Изабелла покровительствовали возникшей в 1478 г. инквизиции; суды и гонения, развернутые этой организацией, в конечном счете вытеснили из страны десятки тысяч евреев и мусульман под предлогом сохранения национального единства и чистоты католической веры[8]. В 1520-х гг. еще одно массовое переселение началось в других регионах Европы, на этот раз в результате Реформации Лютера. Ожесточенное разделение европейских христиан на католиков и протестантов спровоцировало миграцию в масштабах, которых Европа не видела со времен падения Западной Римской империи в V в. и не увидит снова до Первой мировой войны [52].

Причиной самого бесславного массового переселения послужила атлантическая работорговля, начавшаяся через несколько лет после открытия Колумбом Нового Света. В результате деятельности работорговцев к середине XIX в. в Америку были перевезены более 11 миллионов африканцев. Как и обычная морская торговля, этот мрачный бизнес начинался скромно. В 1600 г. около 400 тысяч африканцев были принуждены присоединиться к 250 тысячам европейцев в их колониях в Новом Свете [53]. Но в следующие столетия бесчеловечная практика начала уверенно набирать обороты.

Эта принудительная миграция была обусловлена в основном экономикой. Европа надеялась извлечь огромные богатства из своих новых колоний – из плантаций хлопка, кофе, сахара, табака и индиго, а также золотых и серебряных рудников. Франция и Великобритания заявили права на новые пахотные земли в Северной Америке, Испания и Португалия получили новые территории, протянувшиеся к югу от сегодняшней Калифорнии до Чили. Европа и Средиземноморье представляли готовый рынок для новой продукции. Не хватало лишь рабочей силы. В XV–XVI вв. эту проблему решила работорговля. Европейцы охотились на людей, населявших недавно нанесенное на карты африканское побережье, захватывали их и везли через океан, чтобы обеспечить рабочей силой Северную и Южную Америку. (Местные рабы, возможно, обошлись бы дешевле, но европейские болезни успели ликвидировать резервы рабочей силы среди коренного населения. См. главу 3.)

За последние 500 лет этика миграции претерпела коренные изменения. Как указывают Йен Голдин и другие авторы в книге «Исключительные люди» (Exceptional People), в то время как одни мигранты, в частности беженцы, вынуждены отказаться от дома, потому что обстоятельства оставляют им мало выбора, сегодняшние экономические мигранты, принимая решение о переезде, как правило, пользуются гораздо большей свободой. Там, куда они направляются, они могут получить более высокую заработную плату и качество жизни (и для самих себя, и для иждивенцев, оставшихся дома). Взамен они способствуют росту и оживлению иностранной экономики.

Открытие новых ресурсов и потребительских рынков внесло новое оживление в процесс миграции рабочей силы. В 1975 г. две трети мировой рабочей силы тянули лямку за высокими стенами закрытой протекционистской экономики. Сегодня большинство из нас работают в странах, принадлежащих, по крайней мере формально, к открытой торговой системе. Эти политические и экономические преобразования заставили государства переосмыслить, кому они готовы дать привилегию въезда на свою территорию. К сожалению, исторические и колониальные связи, расовая и национальная дискриминация по-прежнему бросают тень на политику приема иммигрантов. Однако все чаще значение придается возможностям иммигрантов, навыкам, идеям и финансам, которые они могут принести принимающей стороне.

Масштабы современной миграции рабочей силы зависят от точки зрения. В конкретных цифрах общее число людей, живущих за рубежом, выросло в одном поколении на две трети, от 150 миллионов в 1990 г. до почти 250 миллионов сегодня [54]. С другой стороны, за этот период общая численность населения в мире увеличилась почти на 50 %. Если рассматривать глобальные потоки мигрантов как долю от населения мира в целом, это число остается довольно скромным – примерно 3 % – и не меняется с 1980-х гг. [55]. Пожалуй, это могло бы нас немного удивить. В конце концов, мигрантами считаются люди, которые пересекают государственную границу, а границ в последнее время стало больше. В 1980 г. в ООН состояло 154 государства-члена, сегодня их 193. Люди, переезжавшие из России в Казахстан во времена Советского Союза, не считались мигрантами, но считаются ими сейчас.

С этой точки зрения миграция по открывшимся для нас новым маршрутам начинается довольно скромно. Стойкие ограничения, касающиеся работы и жизни за рубежом, означают, что среди всех предметов и явлений, которые могут перемещаться вокруг земного шара, людям это до сих пор удается труднее всего.

Тем не менее они находят способы. В 2004 г. Европейский союз начал экспансию, целью которой было включение некоторых стран Центральной Европы, Восточной Европы и Балтии. Расширение ЕС предоставило населению этих стран право на передвижение, о котором они давно мечтали, но в котором им прежде было отказано. Начиная с 2014 г. более 14 миллионов граждан ЕС живут в одной из стран ЕС, но не в той, где они родились [56]. Во всем мире около 17 миллионов человек ежегодно переезжают в другие страны по визам различных категорий. К ним относятся 3,5 миллиона малоквалифицированных работников, которые мигрируют каждый год из Филиппин и Индии на Ближний Восток, и около 300 тысяч человек, пересекающих границу Мексики и США [57]. С каждым годом мигранты все теснее связывают все регионы мира на семейном уровне.

И нам повезло, что они это делают. В США проживает около 50 миллионов легальных иммигрантов практически из всех стран мира, и, согласно оценкам специалистов, более 11 миллионов незарегистрированных мигрантов [58]. Во многих странах идут бурные политические дебаты о достоинствах и недостатках свободного передвижения людей. Но экономисты единогласно утверждают: мигранты являются основным источником инноваций и будущих рабочих мест, кроме того, свободный поток мигрантов стимулирует экономический рост, развитие инноваций и сокращение бедности.

Неквалифицированные и малоквалифицированные иммигранты в среднем приносят больше пользы работодателям и правительствам, чем местные рабочие, поскольку они, как правило, получают более низкую заработную плату и меньше преимуществ. Эти иммигранты обеспечивают зажиточных людей мира низкими ценами на услуги здравоохранения, уход за детьми и пожилыми людьми, а также (посредством своего непосильного труда в сезонном сельском хозяйстве) дешевыми фруктами и овощами. Они заполняют рабочие места, требующие ручного труда, на которые соглашается все меньше коренных жителей, особенно та растущая их часть, которая получила высшее образование и рассчитывает на вознаграждение. И они платят налоги. (Крупное исследование на основе опыта Великобритании обнаружило, что в первом десятилетии XXI в. иммигранты вернули казне в форме налогов и других общественных благ примерно на 150 миллиардов долларов больше, чем получили в виде государственных пособий.)

Для сравнения, местные жители извлекли из казны 1 триллион долларов [59]. Поскольку иммигранты, как правило, моложе и имеют больше шансов получить работу, чем средний гражданин, они также помогают облегчить старение населения принимающих стран. Старение населения – серьезная проблема для большинства развитых стран, так как чем старше становится население, тем тяжелее делается бремя, налагаемое службами социального обеспечения на остальных наемных работников. (В Европе проблема старения стоит особенно остро: согласно подсчетам экспертов, только для поддержания программы социального обеспечения на нынешнем уровне в период до 2050 г. потребуется еще 1,4 миллиарда работающих по найму иммигрантов. Наиболее вероятный прогноз, однако, выглядит как небольшой рост иммиграции в сочетании с постепенно снижающимся благосостоянием.)

Другие мигранты предлагают дефицитный труд. В Соединенных Штатах две трети рабочей силы, занятой в области науки и техники, составляют иммигранты, а 10 % рабочих мест в сфере IT остаются незанятыми, потому что местные специалисты с достаточной квалификацией не хотят их занимать. В Великобритании около 12 % всей рабочей силы являются иммигрантами, но они заполняют половину всех новых рабочих мест, либо потому, что навыки, которыми они обладают, недоступны внутри страны, либо потому, что они делают работу, за которую никто другой не хочет браться [60].


Международные потоки миграции

Эпоха открытий

Потоки мигрантов пересекают земной шар и соединяют все регионы Rahul C. Basole and Hyunwoo Park, для Pankaj Ghemawat and Steven A. Altman (2014). Мировой индекс связей DHL в 2014 г. По материалам http://www.dhl.com/gci плюс примечания авторов


Но возможно, самое главное во всем этом то, что иммигранты приносят с собой особый колорит. Они привносят свою культуру, язык и идеи и налаживают полезные связи между родиной и принявшей их страной. Плюс ко всему, они демонстрируют в своей работе такое же мужество и находчивость, которые показали при переселении в другую страну. Среди основателей Google (Alphabet), Intel, PayPal и Tesla были иммигранты. В 2005 г. иммигранты возглавляли 52 % всех стартапов Кремниевой долины и 25 % всех американских инженерных и технологических фирм, основанных в предыдущие 10 лет. Американские иммигранты – нобелевские лауреаты, члены Национальной академии наук и оскароносные режиссеры – превосходят своих коллег – местных уроженцев в соотношении 3:1 [61].

По оценкам некоторых экономистов, возвращение к иммиграционному режиму, существовавшему перед Первой мировой войной (когда рабочие могли свободно перемещаться по миру), принесло бы мировой экономике в течение следующих 25 лет 40 триллионов долларов – в 2,6 раза больше, чем нынешний ВВП США – и одновременно более или менее положило конец бедности [62]. «Все иностранцы имеют неограниченное право на въезд и проживание», – заявил в 1872 г. государственный секретарь Великобритании лорд Гренвиль. Тогда величайшая в мире держава не требовала паспортов и не вводила никаких квот на границе. Скорее всего, в ближайшее время режим свободной миграции не вернется – в 2013 г. сенат США проголосовал за выделение дополнительных 45 миллиардов долларов для обеспечения безопасности границ, а в государствах – членах ЕС насчитывается 250 тысяч пограничников, – но представляется очевидным, что, независимо от мнения политиков, людей, сумевших отыскать свой путь за границу, будет становиться все больше [63].

Первый двигатель эмиграции – финансы: эмигрант из развивающейся страны, переехав в США, зарабатывает в среднем в пять раз больше, чем на родине. Второй двигатель – глобальное развитие и рост населения. Страны Центральной и Южной Африки, а также страны Южной и Восточной Азии вырываются из капкана бедности и в скором времени станут обладателями самых крупных в мире (и все более квалифицированных) рабочих ресурсов. Третий двигатель – безысходность. Стихийные бедствия и гонения вынуждают людей отказываться от домов, в которых они больше не могут чувствовать себя в безопасности. Только в 2015 г. миллионы беженцев, спасающихся от гражданской войны в Сирии, хлынули в соседние страны: Ливан, Иорданию и Турцию. Еще миллион бежали в Европу. Там они присоединились к беженцам, спасающимся от конфликтов в Ливии, Эритрее, Ираке и Афганистане, вызвав самый масштабный миграционный кризис на континенте со времен Второй мировой войны [64].


Предыдущий Ренессанс дал человечеству первое представление о самом себе в глобальном смысле. Теперь, после того как мы десятилетиями отгораживались друг от друга, мы снова начинаем видеть полную картину. Потоки путешественников и мигрантов неуклонно увеличиваются, и нас всех неизбежно затронут их труд, культура, языки, связи и потребности, которые они распространяют по всему миру.

Технологии

Новые корабли

Глобальные новые потоки возникли не сами по себе. В эпоху предыдущего Ренессанса новые карты представляли как проблемы, так и возможности. Европейские монархи, банкиры и искатели приключений тратили значительные ресурсы и брали на себя большие риски в надежде решить проблемы торговли с отдаленными территориями и их разведки с целью захвата. Быстро совершенствовалось кораблестроение (возможно, благодаря техническим заимствованиям, сделанным в Китае) [65]. Новые паруса (несомненно, заимствованные у османов) и новые рули повысили скорость и маневренность кораблей. Суда стали больше. Большие корабли были лучше приспособлены к открытому морю и приносили больше прибыли (поскольку их грузоподъемность росла быстрее, чем затраты на нужды команды). К 1600 г. грузоподъемность среднего судна увеличилась с 300 до >1000 тонн [66]. Европа также продолжала изобретать новые способы использования китайского пороха – так появились галеоны, тяжеловооруженные суда, сопровождавшие европейские морские торговые караваны.

Новые инструменты и техники произвели революцию в навигации. Колумб пересекал Атлантику, не имея надежного способа определить широту или долготу, на которой находились его корабли. Он плыл на запад и надеялся на лучшее и, увидев на горизонте Эспаньолу, ошибочно принял ее за Японию (которая на самом деле находилась почти в тысяче километров от него)[9]. Астрономы и математики приняли вызов. Прошло несколько десятилетий, и вот уже любой моряк мог определить широту, замерив с помощью новой астролябии высоту солнца (в ночное время высоту Полярной звезды), а затем заглянув в книгу морских таблиц[10]. Здесь снова ключевое значение имело сотрудничество с мусульманским миром. В начале XV в. османы привезли в Европу арабскую систему счисления, заменившую счеты-абак, и высшую алгебру, без которой не могли быть составлены никакие таблицы [67]. В 1533 г. Реньер Гемма изобрел триангуляцию, что значительно продвинуло ориентирование на суше [68]. Успехи в ориентировании привели к усовершенствованию картографии, вершиной которой стала изданная в 1569 г. карта известного мира, составленная Меркатором.

Технология ведения бизнеса также изменилась. Объемы торговли выросли, и появились новые отрасли услуг, позволявшие поддерживать и облегчать этот процесс. Морские и сухопутные перевозки превратились из индивидуальной деятельности – каждый торговец должен был самостоятельно организовать для себя корабль или обоз из крытых повозок с сопровождением – во внешнюю функцию, которой заведовали специализированные курьерские компании. Они организовывали или покупали грузовые места, а затем перепродавали их торговцам в качестве готового решения. Таким образом купцы могли сосредоточиться на своем основном бизнесе и снизить риски путем закладки фиксированных ставок фрахта в стоимость товара, а мелким торговцам стало легче открывать собственные предприятия. Вместо того чтобы фрахтовать весь корабль, теперь они могли купить часть грузового пространства у компаний, которые предоставляли такую услугу [69].

Аналогичным образом благодаря комиссионным агентам появился новый рынок услуг по продаже и закупке. Крупные торговые дома создавали в больших городах сети постоянных представителей, которые совершали сделки и распространяли информацию от их имени – фирмы меньшего размера не могли позволить себе такую инфраструктуру. Затем в дело вступали агенты-комиссионеры. Устанавливая контакты с множеством клиентов в обмен на разовую плату, они превращали эту солидную фиксированную стоимость в небольшую плату за услугу. Вместе эти новые сферы услуг позволяли даже небольшим фирмам торговать сразу с несколькими удаленными рынками [70].


Новейшие корабли

Новые технологии сегодня играют ту же роль, обеспечивая циркуляцию большего количества разнообразных товаров, услуг и людей. Авиакосмические усовершенствования увеличили дальность полета самолетов и снизили операционные и экологические издержки. Теперь расстояние между любыми двумя городами на земном шаре можно преодолеть максимум за день, и многие из нас могут себе это позволить. В Соединенных Штатах стоимость перелета за последние 30 лет упала на целых 40 % [71].

Формирующийся на земле «интернет вещей» – оснащение всевозможных предметов, от автомобилей до автоматов для продажи кока-колы, небольшими микросхемами и компьютерами, способными устанавливать связь с сетевыми базами данных, – означает, что все больше и больше объектов материального мира приобретают цифровые свойства. Управляемые компьютерами и роботами, такие объекты могут передвигаться с массовостью, скоростью и эффективностью, далеко превосходящими человеческие возможности. На сегодняшний день их численность составляет 15 миллиардов, к 2020 г. таких объектов в мире будет уже 50 миллиардов [72]. Например, в Сеуле вся система общественного транспорта – каждый автобус, такси, поезд и общественный велосипед – теперь подключена к сети [73]. Ожидается, что благодаря этому можно будет быстрее добраться до места назначения, а пробок на дорогах станет меньше, поскольку каждый пользователь и «устройство» в этой сети будет выбирать маршрут, ориентируясь на данные компьютера, сообщающего о ситуации на дорогах.

Интернет вещей изменит объемы и разнообразие материальных потоков на земле. Мы знаем это, поскольку он уже помог сделать это на море. До сих пор именно здесь новые технологии играли самую заметную роль в создании глобальных потоков. «Контейнеризация» способствовала оцифровке грузоперевозок, упаковав все грузы, от автомобилей до цветных карандашей, в идентичные отслеживаемые коробки. Эта революция началась в 1956 г. с появлением контейнерного судна, а к началу 1990-х гг. для приема таких судов были переоборудованы все крупные мировые порты. Сегодня они перевозят 90 % всех тарных грузов [74]. Простая коробка оказалась невероятно эффективной, поскольку устранила самую острую помеху – проблему погрузки и разгрузки. Одинаковые контейнеры требуют одинаковых действий (а это значит, бо́льшую часть работы могут взять на себя машины), их можно быстро и легко переносить с корабля в самолет, поезд или грузовик. В 1990 г. в мире было погружено 25 миллионов контейнеров. Сегодняшние объемы уже подходят к 150 миллионам в год [75].

Эта история широко известна. О том, как изменились маршруты, по которым путешествуют контейнеры, говорят меньше. Нагляднее всего это демонстрируют сами корабли. По мере того как новые карты открывали новые возможности, корабли снова начали увеличиваться в размерах. Те же экономические процессы, которые управляли эпохой предыдущего Ренессанса, правят и сегодня: грузоподъемность кораблей растет быстрее, чем затраты на их строительство и обслуживание. Но в 1984 г. мощность контейнеровоза достигла верхнего предела, составив около 5000 стандартных контейнеров, или ДФЭ (двадцатифутовый эквивалент – единица измерения вместимости большегрузных транспортных средств, эквивалентна объему стандартного контейнера длиной 20 футов (6,096 метра), и оставалась на этой отметке следующие 12 лет.

Однако это произошло не потому, что технологии судостроения зашли в тупик. Нет, дело было в том, что судно вместимостью 5000 ДФЭ (корабли такого класса назывались «Панамакс») было последним по величине, способным пройти через шлюзы Панамского канала. Никто не хотел покупать контейнеровоз, не пригодный для плавания по самому важному маршруту мирового судоходства: каналу, связывающему Атлантическое и Тихоокеанское побережья Америки.

Однако в 1996 г. одна из крупнейших судоходных компаний мира, Maersk из Дании, решила бросить вызов устоявшейся традиции. Она ввела в эксплуатацию судно «Регина» класса «пост-Панамакс» вместимостью 6400 ДФЭ. Экономический центр мира, по мнению Maersk, постепенно перемещался. Панамский канал уже не имел прежнего значения для современных быстро развивающихся торговых путей: тихоокеанских маршрутов, которые соединяли Дальний Восток (Китай, Корея, Япония), «азиатских тигров» (Гонконг, Сингапур, Тайвань) и западное побережье Северной и Южной Америки, атлантических маршрутов, соединяющих Европу с Южной Америкой, и маршрутов Индийского океана, соединяющих Европу с Ближним Востоком и Азией (через Суэцкий канал).

После того как это табу было нарушено, в строительстве контейнерных судов произошел резкий скачок. В 1998 г. корабли преодолели барьер в 7000 ДФЭ. В 1999 г. они достигли 8000 ДФЭ. В 2003 г. были спущены на воду первые корабли вместимостью 9000 ДФЭ, а в 2005 г. появились суда вместимостью 10 тысяч ДФЭ – 61 километр контейнеров на одном корабле. Это была важная веха – возникла новая категория судов, «Суэцмакс», размер которых ограничивался размерами Суэцкого канала. Суэцкий канал в Египте является важным связующим звеном между Средиземноморьем и Индийским океаном, он соединяет Европу непосредственно с Ближним Востоком и Азией, позволяя сократить расстояние и не повторять долгое путешествие Васко да Гамы вокруг южной оконечности Африки. В 2009 г. канал углубили, чтобы сделать его судоходным для кораблей вместимостью до 18 тысяч ДФЭ, в 2015 г. был прорыт второй параллельный канал, что фактически удвоило его пропускную способность. Но сейчас Суэцкий канал тоже утрачивает свое былое значение, а контейнерные суда последнего поколения (например, корабль Средиземноморской судовой компании «Оскар» вместимостью 19 200 ДФЭ, введенный в эксплуатацию в 2015 г.) уже достигли предела его возможностей.

Этот пример наглядно демонстрирует, как сильно изменился мир. Всего два десятилетия назад это было абсурдом – но сегодня строительство подобного левиафана (400 метров в длину, 59 метров в ширину), который не сможет пройти через Панамский канал (и даже через новые, более крупные панамские шлюзы, открытые в 2016 г.) и лишь с большим трудом протиснется через Суэцкий канал, кажется вполне целесообразным. Глобальные объемы торговли восстанавливаются, и в скором времени, возможно, понадобятся еще более крупные контейнерные суда класса «Малаккамакс», для которых будут тесны оба вышеупомянутых канала. Малаккский пролив – еще одно бутылочное горлышко мирового судоходства, соединяющее Тихий океан, Китай и Дальний Восток с Индийским океаном, – то место, где в будущем сосредоточатся основные потоки грузового транспорта. Логика, которая сегодня подсказывает судоходным компаниям, что выгоднее пройти через Суэцкий канал, вместо того чтобы плыть вокруг Африки, все чаще будет сталкиваться с логикой, гласящей, что этот долгий обходной путь вполне оправдан. Постепенно приобретающие все большее значение африканские порты – Дурбан, Момбаса и Дар-эс-Салам – являются важными точками растущих торговых маршрутов между Африкой и Океанией, Африкой и Южной Америкой, а также Западной и Восточной Африкой.

Наконец, как это было и с появлением новых торговых посредников в эпоху Ренессанса, увеличению глобальных потоков сегодня способствуют различные новые платформы платных услуг – в области рекламы, обработки платежей, складирования, обработки данных, профессиональных услуг, привлечения капитала, – которые делают большую бизнес-инфраструктуру доступной для малых фирм с небольшим доходом и помогают многим продавцам выйти на глобальные рынки. Эти платформы обеспечивают нишевые рынки для всего на свете, от мыла с запахом бекона до специалистов по дизайну японского сада камней, развивают модели мелкомасштабных транзакций (микрокредиты, микроплатежи и микроработа), делают возможным высокочастотный трейдинг на Уолл-стрит и глобальный поиск вакансий для тех, кто ищет работу. Возникновение 3D-печати означает, что даже производство постепенно становится платной услугой.

Постоянно расширяется ассортимент продукции, в производстве которой дорогие уникальные формы и штампы для работы с пластмассой и сталью можно заменить на дешевые цифровые чертежи. Затем робот может слой за слоем создать по чертежам материальный экземпляр продукта, в то время и в том месте, где этот продукт понадобится. Инженеры могут применять эту технологию для изготовления слишком сложных для традиционного производства объектов, например деталей ракетного двигателя SpaceX. Также ею могут воспользоваться миллионы дизайнеров, которым не хватает средств или возможностей для того, чтобы создать прототип своего проекта фабричным способом. По мере распространения это «движение производителей» устранит множество материальных потоков, направленных от производителя к потребителю, но вместе с тем создаст новые цифровые потоки, направленные от мастера ко всем без исключения.

Не просто «на связи»

Мы приблизили друг к другу углы карты 1980-х гг., на которой запад находился слева, восток справа, а все остальное не имело значения, и полностью преобразили отношения между государствами, организациями и людьми. Мы превратили окраины – Гуанчжоу в Китае, Сантус в Бразилии, Дурбан в Южной Африке – в центры, где встречаются и смешиваются глобальные потоки товаров, финансов, людей и идей. Мы децентрализованы: решение, принятое в Пекине, в Брюсселе или в виртуальном пространстве, может изменить нашу жизнь точно так же, как решение, принятое в нашей собственной столице. Для нас открыт весь мир, и мы развиваем технологии, которые позволяют нам всюду успеть и все распробовать.

В 1990-е гг. мир был «на связи». Это выражение точнее всего описывало состояние постоянного контакта друг с другом, а также раскрывающиеся перед нами новые возможности. На сегодня оно уже устарело. Оно не способно выразить последствия более чем двадцатилетней политической, экономической и социальной адаптации к новому глобальному контексту. Сейчас мы взаимосвязаны, и наши нынешние отношения выходят за рамки «связей» 1990-х гг. в трех главных аспектах.


Вынужденная близость

Во-первых, в них стало меньше произвольности. Понятие «на связи» предполагает выбор – мы могли выбирать только те связи, которые максимально отвечали нашим интересам. Но теперь мы не можем так легко отказаться от того, что нам не нужно. Не только хорошее, но и плохое в новом многообразии входит в нашу жизнь. Предыдущий Ренессанс стал временем расцвета работорговли. В Новом Ренессансе на подъеме находится незаконная экономика. Согласно оценкам, ее оборот превышает 10 триллионов долларов [76]. Около 20 % всей мировой торговли осуществляется незаконно [77]. Отмыватели денег, торговцы людьми, нелегальные продавцы оружия, контрабандисты, вывозящие опасные отходы, и пираты (онлайн и на море) – все они процветают за наш счет.

Еще больше негатива приходит к нам совершенно на законных основаниях. Глобальные рынки капитала поддерживают рост и финансируют научно-технический обмен, но они весьма непостоянны. От их перепадов внезапно проваливаются в экономическую депрессию целые регионы. Когда в Китае экономика пошла на спад, работодателям во всем мире пришлось сокращать рабочие места и инвестиции. Мировой торговый флот ежегодно переносит из одних областей Мирового океана в другие от 3 до 5 миллионов кубических километров балластных вод. Это вбрасывает в сложившиеся экосистемы чужеродные виды, которые вытесняют местные виды и разрушают их среду обитания. (Только в США биовторжения приводят к потере свыше 120 миллиардов долларов в год) [78]. Коллективный выброс человечеством углекислых газов, согласно прогнозам, к 2100 г. повысит глобальную температуру Земли на 2–4 °C [79]. И многим наверняка не понаслышке знаком опыт Мартина Лютера – пользователи социальных сетей не раз сталкивались с ситуацией, когда высказанное ими мнение распространялось намного дальше и быстрее, чем они рассчитывали.


Узлы

«Взаимосвязанный» мир звучит сложнее, чем мир «на связи», и это действительно так. Опутывающие нас нити множатся, на них сохраняются старые узлы и появляются новые. В эпоху Ренессанса одним из самых прочных старых узлов было невежество. Суеверие и недостаток опыта продолжали препятствовать океанским путешествиям еще как минимум сто лет после того, как это стало возможным. Передовые знания были заключены в ловушку латыни. Тем, кто не мог читать на латыни (то есть подавляющему большинству населения), было трудно делать наблюдения, не говоря уже о том, чтобы принимать деятельное участие в новых открытиях.

Но многие получили возможность читать литературу на родных языках, и это затянуло другой узел: самосознание. Книгопечатание помогло формированию национального самосознания. В устной речи существовали сотни разновидностей английского языка – диалектов, носители которых зачастую не понимали друг друга. В печати их было всего несколько. Благодаря более однородному коммуникативному полю люди, говорившие на английском, французском, испанском, итальянском и немецком языках, постепенно начали осознавать, что каждый из них принадлежит к гораздо более широкому сообществу, чем он мог себе представить, – к нации [80]. В XVI в. подъем национального самосознания способствовал появлению блестящих литературных произведений – сочинений Уильяма Шекспира (1564–1615) на английском языке и Мигеля де Сервантеса (1547–1616) на испанском. Но вместе с тем он способствовал развитию национализма – идеи о соперничестве своей нации с другими нациями – и дал людям новый, более удобный инструмент для того, чтобы смотреть свысока, проявлять недоверие или совершать насилие в отношении «чужих». В этот период также сформировалось религиозное самосознание (спровоцировавшее немало переселений беженцев, упомянутых выше).

Сегодня невежество по-прежнему препятствует тем силам, которые подталкивают человечество к объединению. Коренной проблемой остается языковой барьер. Английский язык, как ранее латынь, является общим языком, объединяющим образованных людей. Он служит хорошим посредником в вопросах международной политики, бизнеса и науки. Но так же, как ранее латынь, он неизвестен большинству людей (примерно 75 %), и этим людям труднее воспользоваться возможностями, которые дают наши глобальные взаимосвязи. Лучший пример – интернет. Количество неанглоязычного интернет-контента растет, но в 2015 г. более половины (55 %) всех сайтов по-прежнему были написаны на английском [81]. (На долю следующего по популярности языка интернета, русского, приходится лишь 6 %.) Этот барьер работает в обоих направлениях. Почти четверть всех пользователей интернета говорит на мандаринском диалекте китайского языка [82]. Те из нас, кто не знает этого языка, вряд ли смогут поучаствовать в их разговорах и разделить их интересы или идеи.

Национальное, религиозное и иные формы самосознания по-прежнему остаются нераспутанным узлом. По большому счету современный европейский проект политического союза является аномалией. Тенденции последних пятидесяти лет, наоборот, свидетельствуют о том, что страны стремятся к отделению, а не объединению – национальные меньшинства приходят к выводу, что им будет удобнее обустроить собственное однородное общество, судьбу которого они смогут решать самостоятельно. Движения за независимость реализуют одну из самых главных ценностей человечества: самоопределение. Но есть и побочные эффекты. Умножение формальных границ препятствует потокам товаров, финансов, людей и идей, в зависимости от политики, которую устанавливает у себя каждая страна. Еще больше тревог вызывают радикальные формы насилия, порой сопровождающие стремление к отделению и перерастающие в терроризм и гражданские войны, этнические или религиозные чистки. С утверждением национального или религиозного самосознания были связаны самые уродливые и трудноразрешимые конфликты последней четверти века: Северная Ирландия, Сомали, Руанда, бывшая Югославия и Чечня в 1990-е гг.; Дарфур, Судан, Украина, Ирак и Сирия в XXI в., непрекращающаяся борьба между Израилем и Палестиной, спор между Индией и Пакистаном за Кашмир и многие другие. Менее кровопролитные, но все же достаточно заметные конфликты кипят между разными расами в США, между народами Евросоюза, между этническими группами в Китае и России, между религиями в Индии и между христианами и мусульманами.


Соперничество

И наконец, когда мы «на связи», это предполагает движение навстречу друг другу и атмосферу сотрудничества. Мы действительно все больше сотрудничаем в пограничных вопросах безопасности, экономики и охраны окружающей среды. Глобальная торговля энергией, благодаря которой в мире не гаснет свет, говорит о нашей глубокой взаимозависимости, выходящей за рамки геополитических разногласий. В 2015 г. 195 государств, основываясь на научных прогнозах, подписали Парижское климатическое соглашение о переходе в XXI в. на альтернативные виды топлива.

Но соперничество подталкивает нас к новым завоеваниям. Возможно, мы видим мир новыми глазами, но мы все еще не потеряли желания контролировать свою часть этого мира.

Все территориальные «открытия» предыдущего Ренессанса сводились, по сути, к борьбе с местными жителями, которые населяли эти земли задолго до прихода европейцев. При этом каждый новый захват порождал новый виток противостояния в Европе. Вскоре после обнаружения Нового Света между Испанией и Португалией разгорелся юридической спор о правах на эти территории. Колумб совершил свое плавание от имени Испании, но в заключенном ранее соглашении 1479 г., когда главная ось разведки еще была направлена с севера на юг, вдоль берега Африки, Испания согласилась уступить Португалии любые земли «к югу от Канарских островов» (в их число, как оказалось, вошло и «открытие» Колумба). В конце концов соперничающие империи подписали в 1494 г. новый Тордесильясский договор, согласно которому мир был заново разделен на две части, восточную и западную, вдоль меридиана, проходящего в «370 лигах к западу от островов Кабо-Верде». Испания закрепляла за собой все новые земли к западу от этой линии, Португалия – все земли к востоку. (Восточная оконечность Южной Америки, обнаруженная в 1500 г., оказалась частью массива суши, уходящего дальше на восток от разделительной линии, поэтому бразильцы сегодня говорят на португальском языке, а не испанском, как их соседи.) Конечно, если бы два воображаемых корабля отправились от этой линии в противоположных направлениях, через 180° они встретились бы снова. Именно соперничество побуждало картографов переделывать карты мира, подгоняло Магеллана в его дерзком кругосветном путешествии и заставило европейскую знать признать настоящий облик мира – и целью этого соперничества было провести разделительную линию между владениями Испании и Португалии на другой стороне земного шара (и выяснить, на чьей половине находятся коммерчески важные Острова пряностей). Ренессанс не только открыл мир, но и разделил его.


Международные потоки нефти

Эпоха открытий

Глобальная торговля нефтью бросает вызов глубоким геополитическим разногласиям

BP (2015). Statistical Review of World Energy (64th Ed.). London: BP


Сегодня соперничество по-прежнему лежит в основе наших глобальных поисков. Распространение демократии и рыночной экономики, помогая наладить контакты между странами и увеличить благосостояние их жителей, одновременно замыкает восток в подобии холодной войны, непропорционально продвигая вперед американские и европейские интересы. Растущая диаспора русскоязычного населения в Восточной Европе может помочь завязаться новым отношениям в этой части мира, но вместе с тем дает предлог для вмешательства во внутреннюю политику соседей. Международное сотрудничество США, Канады, России и Дании в исследовании морского дна в Арктике – одной из самых отдаленных и суровых территорий на планете – направлено в конечном итоге на раздел между этими державами новых месторождений нефти и полезных ископаемых.


В политическом, экономическом и социальном плане новый мир изменился по сравнению со старым до неузнаваемости. Он превратился в глобальное переплетение проблем и решений, стимулов и препятствий, взаимозависимостей и конфликтов, которые опутывают всех нас. В следующей главе мы покажем, что делает этот момент лучшим в истории моментом для жизни.

3

Витрувианский человек

Как здоровье, богатство и образование человека достигли новых высот

В этом веке мы увидели больше прогресса… чем наши предки за прошедшие четырнадцать веков.

Пьер де ла Раме (1515–1572) [1]

Одним из величайших достижений предыдущего Ренессанса было возникновение понятия, которое в конечном итоге стали называть прогрессом. На фоне осязаемых масштабных перемен началось широкое философское переосмысление человеком своего места в мире: если раньше он считал, что занимает важное, но неизменное положение в середине Великой цепи бытия (между Богом и дьяволом), то теперь он увидел, что может разорвать эту цепь и самостоятельно определить свою судьбу. В истории философии это был важный шаг вперед, отделивший Европу раннего Нового времени от средневекового прошлого[11].

Осознание человечеством своих прогрессивных возможностей было выражено в 1486 г. в «Речи о достоинстве человека» (Oratio de hominis dignitate) Джованни Пико делла Мирандолы (1463–1494):


Эпоха открытий

Форма, полная возможностей

Леонардо да Винчи (около 1490 г.). Витрувианский человек. Венеция, Италия. Из собрания музея Академии

Образ прочих творений определен в пределах установленных нами [Богом]законов. Ты же, не стесненный никакими пределами, определишь свой образ по своему решению <…> чтобы ты сам, свободный и славный мастер, сформировал себя в образе, который ты предпочтешь. Ты можешь переродиться в низшие, неразумные существа, но можешь переродиться по велению своей души и в высшие божественные[12] [2].

Это сочинение нередко называют манифестом Возрождения. Во-первых, дело в его происхождении: оно в наукообразной форме выразило суть проникнутой новыми взаимосвязями эпохи. Автор изучал церковное право (на латыни) в Болонье и греческую философию (на греческом) в Падуе, он познакомился с ивритом, арамейским и арабским языками во Флоренции и Париже. Его целью было открытие фундаментальной философии человеческой природы, которая объединила бы христианскую, греческую, иудейскую и другие отрасли философской мысли. Во-вторых, дело в очевидно современной теме: по мнению автора, мы можем достичь более высокого состояния бытия, если будем прикладывать к этому хотя бы некоторые усилия [3].

«Речь о достоинстве человека» имеет много общего с культовым изображением эпохи Ренессанса, «Витрувианским человеком» Леонардо да Винчи (1490). Круг – это небеса, гармоничные и совершенные. Квадрат – четыре угла, четыре стихии, четыре времени года – это земля [4]. Размещая человека в центре этих фигур, Леонардо символически передает нашу способность пребывать и в той и в другой стихии и призывает нас реализовать божественный потенциал, заключенный в нашей природной форме. Мы смотрим и видим, чем могли бы быть.

От невзгод к среднему классу

У художественного произведения Леонардо был аналог в реальной жизни. С точки зрения материального благополучия – здоровья и богатства – европейцы достигли в эпоху Возрождения новых высот, что было особенно заметно на фоне предыдущего столетия.


Худшие времена

В 1346 г. монгольское войско, пришедшее из Азии, осадило портовый город Кафу (на территории современного Крыма). Монголы принесли с собой страшную болезнь – чуму, и, согласно широко распространенному мнению, с помощью катапульт «перебрасывали трупы [умерших от чумы воинов] через городские стены, рассчитывая, что невыносимая вонь убьет всех, кто скрывался внутри… Вскоре разлагающиеся трупы отравили воздух и воду, вонь была такой сильной, что едва одному из нескольких тысяч удалось бежать от остатков [монгольской] армии» [5]. Те, кому удалось спастись, вероятно, разнесли чуму вдоль Средиземноморского побережья и стали причиной одной из самых крупных пандемий в истории. В 1347–1353 гг. болезнь, которую называли «черной смертью», уничтожила, согласно разным оценкам, от одной трети до половины всего населения Европы – 75 или более миллионов человек [6]. Даже в далекой Англии погибло от 30 до 50 % населения [7]. Средиземноморский регион пострадал еще сильнее. Население Флоренции сократилось на две трети – со 120 тысяч жителей перед чумой до 40 тысяч после [8].

Вымирание населения и тяготы, вызванные чумой, в сочетании с войнами (в частности, Столетней войной между Францией и Англией (1337–1453) и завоевательными походами Османской империи в 1352 г. и далее) привели к глубокому экономическому кризису на всем континенте. Сельское хозяйство пришло в упадок – крестьян не хватало, работать на полях было некому, люди, которым удалось пережить чуму, голодали. Не хватало даже денег. Собственные рудники Европы почти истощились, а война с турками препятствовала поступлению золотых слитков с Золотого Берега Западной Африки. Королевские дома стонали под тяжестью международных долгов.

Это было опасное и полное несчастий время.


Лучшие времена

Но начиная с 1450 г. ситуация в Европе начала меняться. В одно и то же время, в 1453 г., Франция и Англия решили на время забыть о своих давних территориальных спорах, а итальянские державы (Милан, Венеция, Флоренция, Неаполь и Папская область) подписали соглашение о взаимном ненападении (Лодийский мир), что позволило им всем пользоваться экономическими преимуществами мирного времени. Природный иммунитет людей постепенно рос, и страшные вспышки чумы отступили, оставив в Европе эпохи Возрождения малочисленное, более молодое и более выносливое поколение, готовое и способное участвовать в восстановлении жизни на континенте.

Для тех, кто смог пережить чуму, уровень жизни во всех слоях общества начал расти. Среди крестьян демографический кризис спровоцировал серьезные структурные изменения. Некогда плодородные поля дичали из-за нехватки людей, которые могли бы их обрабатывать. Чтобы привлечь на землю дефицитный крестьянский труд, землевладельцы были вынуждены сокращать арендную плату и улучшать условия жизни. Во Франции король пошел еще дальше и сразу предложил крестьянам в собственность небольшие участки – это позволило возобновить обработку заброшенных полей, начать осваивать новые земли и тем самым расширить общую площадь сельскохозяйственных угодий. (Для короны ситуация оказалась выигрышной со всех сторон: поля были вспаханы и засеяны, крестьяне сыты, а казна получила новую широкую налоговую базу, которая при этом относилась к королевским сборщикам налогов намного лояльнее, чем к представителям знати [9].) Во всей Западной Европе феодальное крепостничество (когда крестьяне обрабатывали землю, принадлежащую их господину) постепенно уступало этой новой системе. Все больше и больше крестьян брали землю в аренду или приобретали в собственность и получали возможность выставлять на продажу излишки продукции и свое свободное время.

Рост крестьянского благосостояния стимулировали также новые промышленные и торговые связи. Для большинства сельских жителей это был первый случай, когда они могли самостоятельно распоряжаться своим трудом. Городская промышленность, находившаяся в разгаре восстановления, передавала часть производственного процесса появившемуся новому контингенту (дешевых) работников. Крестьяне, не занятые посадкой или сбором урожая, могли зарабатывать, выполняя мелкую работу на заказ для торговцев из близлежащих городов – прясть или изготавливать ремесленные изделия. Начало улучшаться питание: более сытные и калорийные продукты из Нового Света (сладкий картофель, арахис, различные виды бобов, сахарный тростник, а после 1540 г. кукуруза) постепенно наполняли европейские (а также китайские, индийские и африканские) желудки [10]. В следующие 200 лет этот сельскохозяйственный обмен заметно улучшил здоровье европейцев (чего нельзя сказать о табаке, появившемся после 1560 г.). Население континента увеличивалось и около 1570 г. вернулось к доэпидемической численности [11].

Восстановилась торговля по старым маршрутам, и появилась новая межконтинентальная торговля. Это обеспечивало устойчивый рост спроса на сельскохозяйственные и промышленные товары. Торговые связи между городом и деревней постепенно крепли, усовершенствованные методы ведения сельского хозяйства получали все более широкое распространение, и крестьяне в некоторых регионах стали частично или полностью отказываться от выращивания традиционных зерновых культур, например пшеницы, и отдавать свои земли под выращивание более дорогих товарных культур, например винограда.

Те, кто смог воспользоваться этими новыми обстоятельствами, получили достаточно стабильный источник дохода и удовлетворительный уровень жизни. Преуспевающие крестьяне образовали своего рода сельскую аристократию – многие из них строили дома, которые до сих пор разбросаны по всей Западной Европе (и зачастую находятся далеко за пределами покупательской способности среднего класса XXI в.).


Эпоха открытий

Дом зажиточного крестьянина в Уорвикшире, Великобритания, построенный около 1480 г.

Фото: Nat Alcock and Dan Miles (2012). Из книги The Medieval Peasant House in Midland England. Oxford: Oxbow Books


Жизнь в городах также изменилась в лучшую сторону. Здесь пример подали средиземноморские города Италии. Они были бедны ресурсами, но богаты возможностями. С точки зрения развития материальной инфраструктуры и социальных систем, сложившихся вокруг торговли, коммерции и банковского дела, они намного опережали остальные страны Европы, и такие города, как Венеция и Флоренция, быстрее прочих извлекли выгоду из изменившихся обстоятельств. Венеция контролировала ввоз пряностей в Европу и была также главным портом доставки фарфора, драгоценных камней, духов, шелка и других предметов роскоши из стран Азии и Леванта. Кроме того, она была крупным производителем шерсти и шелка, стекла и серебра, мыла и парусных судов, а к 1500 г. стала главным в мире центром книгопечатания. Флоренция, где обосновались Медичи, была одним из крупнейших финансовых центров Европы. В 1500 г. Италия демонстрировала самый высокий показатель ВВП на душу населения на Земле. Итальянцы были примерно на 30 % богаче, чем в среднем жители Западной Европы, и в два с половиной раза богаче, чем жители великих империй – Османской, Египетской или Японской [12].

В эпоху Возрождения эти богатства распространились за пределы Средиземного моря в другие регионы Европы. Географические открытия существенно обогатили Испанию и Португалию. Бо́льшая часть средств была сосредоточена в руках дворянства, купцов и банкиров, но и жизнь простых людей в атлантической части Европы во многом улучшилась благодаря стремительному росту экономической активности. Портовые города Европы на побережье Атлантики стали новыми центрами коммерции, куда стекались предприимчивые купцы, моряки и сельские ремесленники в поисках серебра из Нового Света. Рост городского населения стимулировал спрос на промышленные товары и возникновение новых рабочих мест – в ремесленных гильдиях и профессиональных коллегиях, в качестве разносчиков, лавочников и слуг, а также представителей власти, занятых поддержанием порядка, сбором налогов и ведением учета[13].

Появление последней категории рабочих мест говорило об одном из самых больших благ для горожан: укреплении государства. Налоговая база расширялась, а значит, государству нужно было больше сборщиков налогов и бухгалтеров. Для торговых предприятий, морских путешествий и строительства империи нужно было больше послов, капитанов и клерков. Новые методы борьбы с болезнями (карантин) требовали больше врачей и чиновников, которые могли обеспечить соблюдение правил. Появление, а затем распространение пороха – начиная с турецких пушек, разрушивших стены Константинополя в 1453 г., и заканчивая ручными аркебузами, с помощью которых испанцы победили французов в битве при Чериньоле в 1503 г., – спровоцировало гонку вооружений, финансирование и применение новых видов оружия и строительство новых укреплений. Для этого требовались более многочисленные и лучше обученные армии, больше инженеров, больше специалистов по военному делу и больше чиновников, которые могли всеми руководить. Это государственное строительство, происходящее в ответ на перемены в мире, означало появление большего количества лучше оплачиваемых рабочих мест для горожан. С 1480 по 1520 г. французский королевский двор в Париже вырос в два раза. То же произошло с королевскими дворами других стран. Для выдающихся людей это увеличило шансы подняться выше обстоятельств своего рождения, поскольку многие монархи предпочитали приближать к себе компетентных простолюдинов, чем давать слишком много власти представителям старых феодальных семей. В Испании некоторые члены королевского совета были выходцами из крестьян. Один из самых известных реформаторов образования той эпохи, Пьер де ла Раме (1515–1572), начинал жизнь сыном углежога, а закончил королевским профессором риторики в Париже.

В городах росла прослойка среднего класса – купцы, предприниматели и их работники, квалифицированные ремесленники, художники и подмастерья, государственные чиновники. (Последние сыграют важную роль в процветании, о котором пойдет речь в части II.) Но и для тех, кто остался бедным, положение тоже улучшилось благодаря быстрому распространению новых представлений о бедности. Отношение общества к этой проблеме стало более сознательным. Художественная литература переключилась с описания средневековых рыцарей и заблудившихся пастушек на современные невзгоды, разворачивающиеся на фоне пустынных городских пейзажей. Английский гуманист Томас Мор (1478–1535) придумал слово «утопия» и употребил его в одноименной книге в 1516 г., чтобы привлечь внимание к реальности, которая не оправдывала его ожиданий.

Ревизионистские настроения текущего момента привели мыслителей, разделяющих воззрения Мора, к мысли, что бедность вовсе не является неистребимой язвой на теле общества, как считали ранее. Радикальные способы решения этой проблемы распространялись, в частности, на волне другой быстро распространяющейся идеи – протестантской Реформации, о которой подробнее рассказано в главе 7. Для католиков милостыня представляла акт христианской добродетели, а значит, ее совершали добровольно. Протестанты уделяли больше внимания росту социальных проблем, связанных с попрошайничеством и бродяжничеством, и стремились искоренить их на государственном уровне. Почти одновременно в 1520-е гг. около 60 западноевропейских городов, в которых преобладал протестантизм, разработали централизованную систему помощи бедным. Предпринятые ими меры различались в деталях, но все они включали в себя запрет на попрошайничество, введение для более состоятельных граждан обязательного налога в пользу бедных, займы под низкие проценты, позволявшие сократить количество нуждающихся в периоды временного безденежья, и создание программ повышения квалификации, помогавших беднякам стать матросами, слугами или другими полезными членами общества [13].

С точки зрения здоровья и богатства предыдущий век был одним из худших на памяти многих европейских поколений. Но внезапно для всех слоев общества, от крестьянских хижин до королевских дворцов, новый век стал одним из лучших.

Новый золотой век

То же самое мы можем сказать сегодня. Несмотря на множество невзгод, которые до сих пор терзают наш мир, с точки зрения глобального здоровья и благосостояния сейчас действительно самое лучшее время для жизни – даже для наименее благополучных людей в мире. Шансов избежать бедности и прожить долгую здоровую жизнь в настоящее время намного больше, чем у любого предыдущего поколения.

И на этот раз эти преимущества распространяются почти на весь мир.


Во всех слоях общества здоровье человека находится на самом высоком уровне за всю историю

Одним из наиболее важных показателей здоровья человека является ожидаемая продолжительность жизни при рождении. «Как долго мы проживем?» – возможно, единственный вопрос, который наиболее наглядным образом выводит среднее арифметическое из всех факторов, от которых зависит наше здоровье: качества питания и образа жизни, болезней, лекарств и развития медицинской науки, вероятности войн и катастроф.

С этой точки зрения нынешний век представляет собой беспрецедентное явление. С 1960 г. ожидаемая средняя продолжительность жизни в мире увеличилась почти на два десятилетия, приблизительно с 52 лет до 71 года [14]. В прошлый раз для увеличения продолжительности жизни на двадцать лет понадобилось целое тысячелетие (хотя основной прогресс в этой области был достигнут после 1850 г.), – на этот раз хватило всего пятидесяти лет. В 1990 г. только треть умерших успела отметить свое семидесятилетие. В 2010 г. их была уже почти половина, и почти четверть всех умерших составляли восьмидесятилетние. Всего за два десятилетия восемьдесят стали новыми семьюдесятью [15].

Эти успехи носят по-настоящему глобальный характер. Ребенок, родившийся сегодня почти в любой стране, может прожить дольше, чем в любое другое время в истории этой страны. Начиная с 1990 г. ожидаемая продолжительность жизни при рождении выросла на 7 лет в Южной Азии, на 6 лет в Восточной Азии, на Ближнем Востоке, в Северной Африке и Латинской Америке и на 4 года в Центральной Азии и развивающихся странах Европы. Даже в странах Центральной и Южной Африки, где отмечаются наименее благоприятные экономические условия и свирепствует ВИЧ/СПИД, младенцы, родившиеся сегодня, могут прожить на шесть лет дольше, чем в 1990 г. Некоторые страны совершили и вовсе невообразимый скачок. Средняя продолжительность жизни в Эфиопии и Бутане увеличилась на 15 лет (с 47 до 62 и с 52 до 67 лет соответственно), на Мальдивах и в Камбодже – на 16 лет (с 61 до 77 и с 55 до 71 соответственно). Некоторые страны (Южно-Африканская Республика и Лесото, где ВИЧ/СПИД сократил среднюю продолжительность жизни на 20 лет, а также Сирия, где то же самое произошло в результате гражданской войны), наоборот, переживают серьезный регресс, но это скорее исключения на фоне необыкновенного глобального прогресса в области здравоохранения.


Во всех слоях общества благосостояние вышло на самый высокий уровень за всю историю

По большому счету самые важные успехи в области благосостояния делают не состоятельные, а бедные слои населения, для которых увеличение доходов и накопление имущества означает иное качество жизни и возможность выбора.

Сегодняшние бедняки не слишком отличаются от бедняков эпохи Ренессанса: за последние пятьсот лет жизнь у подножия пирамиды на удивление мало изменилась. Тогда быть бедным означало, что вы живете впроголодь на хлебе, овощах и каше, а мясо для вас редкая роскошь. Одни бедняки нанимались на мелкую ручную работу, другие открывали микробизнес – доставляли уголь или вывозили нечистоты. Большинство кое-как сводили концы с концами, понемногу сочетая то и другое и добавляя сверху еще немного стойкости. От 60 до 80 % заработанных средств они тратили на еду, остальное в основном на одежду и жилье. Они жили в стесненных условиях, а из имущества у них было в лучшем случае немного старой одежды, набитый соломой мешок для сна, стул и, возможно, стол. Остальные необходимые вещи, которые они не могли позволить себе купить, они выпрашивали, делили с кем-нибудь или обходились без них.

В наше время в условиях крайней бедности, согласно определению Всемирного банка, живут люди, дневной бюджет которых составляет менее 1 доллара 90 центов. Эти люди также питаются в основном злаками. Более обеспеченные из них продают свой труд или открывают примитивный бизнес: готовят уличную еду, шьют одежду или продают время разговора по своим мобильным телефонам. Они тратят примерно 55–80 % своего дохода на продукты питания, остальное на другие предметы первой необходимости. Живут они домохозяйствами по 6–12 человек. Исследование, проведенное среди людей, живущих в крайней бедности в Западной Индии, выявило, что в большинстве домов имеется кровать или детская кроватка, но только у 10 % есть табуретки, и у 5 % – стол. Они хронически недоедают и страдают дефицитом красных кровяных телец (анемией) [16], истощены, часто болеют и имеют серьезные шансы заработать проблемы со зрением или другие заболевания, ведущие к инвалидности. Подробности различаются в зависимости от места, но общая картина остается одинаково мрачной [17].

К счастью, крайняя бедность распространена намного меньше, чем это было еще 25 лет назад. Мы переживаем момент по-настоящему глобального экономического роста. В 1990–2014 гг. реальный доход на душу населения вырос в 146 из 166 стран и территорий, о которых имеются статистические данные [18]. В мировом масштабе реальный ВВП на душу населения в 2014 г. превысил 8000 долларов, став почти на 40 % выше, чем в 1990 г. [19]. Несмотря на недавние кризисы, существующие сырьевые и экономические ресурсы способны изменить жизнь подавляющего большинства человечества.

И эти изменения идут полным ходом. За последние несколько десятилетий бедность во всем мире резко сократилась. Когда пала Берлинская стена, около 2 миллиардов человек (43 % мирового населения), по оценке Всемирного банка, жили за чертой бедности. В 2015 г., несмотря на то что численность человечества за это время увеличилась на 2 миллиарда, абсолютное число случаев крайней бедности сократилось более чем в два раза, до 900 миллионов человек (12 % человечества) – их по-прежнему слишком много, но улучшение не может не бросаться в глаза [20]. Впервые в истории число бедняков значительно сократилось на фоне заметного роста общего количества населения Земли [21]. Полвека назад специалисты по развитию не сомневались в том, что крайняя бедность является неистребимой болезнью человечества – сегодня они обсуждают, сколько лет пройдет, прежде чем мы сможем окончательно от нее избавиться: сорок, тридцать или двадцать.

В Китае, чьи 1,4 миллиарда человек населения составляют одну пятую человечества, за 30 с лишним лет стабильного 8-процентного экономического прироста средний доход населения увеличился в среднем в 20 раз и вывел из нищеты около 500 миллионов человек [22]. Китаю можно предъявить много претензий, в том числе из-за того, каким способом он решает свои нынешние экономические проблемы, но нельзя не восхищаться тем, как он решительно порвал со своим нищим прошлым. Это самая успешная история развития в мировой истории. От Китая почти не отстает Индия. С 1990 г. ее экономика также растет почти на 8 % ежегодно, а доля населения, живущего в условиях крайней бедности, сократилась почти вдвое, с >50 % приблизительно до 30 % [23].

Несомненно, самые большие успехи по борьбе с бедностью были сделаны в этих азиатских гигантах, но Африка, несмотря на поздний старт, уверенно их догоняет. С экономической точки зрения 1990-е гг. были для Африки потерянным десятилетием. В Центральной и Южной Африке экономический рост выражался в отрицательных цифрах: –1,1 % на душу населения; The Economist назвал Африку «безнадежным случаем» [24]. Но начиная с 2000-х гг. экономика континента пошла в гору. ВВП начал стабильно расти примерно на 5 % в год, и в нынешнем тысячелетии шесть стран из десяти, сделавших самые крупные экономические успехи, были африканскими [25]. Хотя экономика сорока стран Центральной и Южной Африки по-прежнему испытывает серьезные проблемы, коллективный ВВП региона (1,7 триллиона долларов в 2014 г.) [26] сегодня примерно равен ВВП России и, как ожидается, будет продолжать расти примерно на 4–7 % в год в течение всего следующего десятилетия [27]. Доля крайне бедных граждан в странах Центральной и Южной Африки сократилась с почти 60 % в 1993 г. до <50 % в настоящее время и имеет тенденцию к устойчивому снижению.

В целом сегодня мир стал гораздо богаче и предлагает бедным гораздо больше возможностей и выбора, чем всего лишь четверть века назад.


Во всех слоях общества образование вышло на самый высокий уровень за всю историю

Одним из первых решений, которые люди принимают, когда у них появляется возможность выбора, становится решение потратить больше времени на обучение. Образование одновременно является следствием развития – выбором, который делают люди, имеющие возможность выбирать, – и катализатором дальнейших успехов в сфере здравоохранения и образования.


Массовое образование

Предыдущий Ренессанс превратил образование из необязательной роскоши в ценный ресурс, отвечающий практическим и духовным потребностям множества людей.

В 1450 г. на континенте было менее 50 университетов. В 1550 г. их стало почти в три раза больше [28]. Приток в университеты немецких студентов, число которых на протяжении средневекового периода оставалось неизменно низким, увеличился за это столетие в два раза [29].


Эпоха открытий

В эпоху Возрождения университеты распространились по всей Европе

Hilda de Ridder-Symoens (1996). A History of the University in Europe. Cambridge, UK: Cambridge University Press


С одной стороны, количество студентов росло пропорционально увеличению общей численности населения. Но дело было также и в том, что социальный состав студентов, ранее состоявших преимущественно из духовенства и дворянства, расширился за счет горожан. Все более усложняющиеся финансовые, коммерческие и торговые предприятия требовали более грамотных работников, процветающие государственные бюрократические структуры нуждались в большем количестве людей с юридическим образованием. Хорошая работа была доступна тем, кто получил хотя бы часть требуемого образования, поэтому популярность образования росла на глазах. В то же время новые технологии (книгопечатание) значительно облегчили доступ к образованию, дав людям помимо традиционного (и дорогостоящего) устного обучения возможность недорогого самостоятельного обучения.

С другой стороны, количество студентов росло из-за распространения новых представлений о ценности образования – здесь важную роль сыграло движение гуманизма (который способствовал возрождению интереса к античным авторам) и переосмысление религиозных истин на волне протестантской Реформации. Основой высшего образования в Средние века было богословие, право и медицина – предметы, полезные только для узких специалистов. Многие люди не видели надобности даже в элементарном обучении чтению, письму и счету. Но протестанты, которые начиная с 1520-х гг. взяли штурмом половину континента, так не считали. Одно из основных различий между протестантами и католиками заключалось в убеждении первых, что для поклонения Богу людям не нужен посредник (то есть священник) – все, что нужно знать, уже написано в Библии, в том числе в ее переводных версиях. Внезапно чтение оказалось новым путем к спасению, и у каждого верующего появилась веская причина, чтобы узнать, что означают эти завитки на бумаге. Стремясь вернуть людей к исконной христианской вере, многие протестанты выступали за передачу школьного образования, ранее находившегося в ведении монастырей, в руки государства. Идея была подхвачена амбициозными монархами, стремившимися укрепить свой авторитет, что привело к открытию массы новых государственных университетов.

Гуманизм зародился в предыдущем столетии, и не последнюю роль в его развитии сыграл человек по имени Петрарка (1304–1374). Одержимый Древней Грецией и Древним Римом, Петрарка путешествовал по самым известным местам Античности, собирал монеты и даже писал письма умершим знаменитостям прошлого. Кроме того, он был политиком, и ему удалось найти родственные души среди флорентийской знати. Его стараниями флорентийские градоправители оказались окружены почти осязаемым мифологическим ореолом: они стали воплощением древнеримских республиканцев, хранителями гражданских добродетелей, защищающими их от современного воплощения имперского разврата – папства. В современной ему Италии Петрарка снова вызвал к жизни политические дебаты античного мира.

Когда в следующем столетии сокровищница классических произведений была восстановлена и заново издана с помощью чудесного изобретения Гутенберга, мечта Петрарки о возрождении античного величия вдруг стала реальностью, и это придало образованию новый престиж и смысл. Со временем акценты сместились, и средневековую учебную программу сменили так называемые гуманитарные науки: грамматика, риторика, история, поэзия и философия морали – отрасли знания, направленные не на обучение узких специалистов, а на воспитание способных и добродетельных граждан. Эта учебная программа, предназначенная для более широкой аудитории, вдохновила появление ряда новых школ. В некоторых из них идея расширения доступа к общему образованию была переосмыслена еще более радикально. В светскую школу-интернат Витторино да Фельтре «Дом радости» принимали не только мальчиков, но и девочек, которые также могли воспользоваться учебной программой, составленной по античным образцам и включавшей, среди прочего, рисование, музыку и физическое воспитание [30].

Всего за один век роль образования в глазах общества изменилась, превратившись из диковинки, предназначенной для немногих, в массовое средство раскрытия человеческого потенциала.


Всеобщее образование

В наше время мы перевели гуманистическое стремление к воспитанию достойного активного гражданина на юридический язык прав человека. Статья 26 Всеобщей декларации прав человека, принятой в 1948 г. и являющейся первым глобальным определением прав, которыми обладают все люди, утверждает: «Каждый человек имеет право на образование» и «Образование должно быть направлено на полное развитие человеческой личности».

Мы немало продвинулись на пути к реализации этой концепции, начав с основы любого образования – грамотности. В 1980 г. почти половина мирового населения (44 %) было неграмотным. Сегодня, несмотря на быстрый рост численности населения, эта доля значительно сократилась и составляет всего лишь одну шестую. Всего через десятилетие ряды человечества пополнились тремя миллиардами грамотных. Интернет, как ранее книгопечатание, стал эффективным новым поводом научиться читать и писать. Среди молодежи неграмотность составляет всего 10 %, и эта цифра постепенно снижается – а это значит, что почти все будущее поколение взрослых будет обладать базовыми навыками, позволяющими воспользоваться новыми информационными ресурсами человечества [31].

Переход на следующую ступень, то есть введение организованного школьного обучения, также происходит во всем мире. С 1990 г. число детей, посещающих начальную школу, в странах Центральной и Южной Африки возросло более чем в два раза, и по состоянию на 2015 г. в развивающихся странах 91 % детей младшего школьного возраста посещали учебные заведения (для сравнения, в развитых странах этот показатель равен 96 %) [32].

Сейчас во всем мире 18 детей из 20 заканчивают начальную школу и переходят в среднюю (для сравнения, в 1990 г. таких детей было 15 из 20) [33]. В разных регионах прогресс происходит неравномерно, но явный регресс наблюдается лишь в немногих странах.

Важно отметить, что гендерный разрыв в школьном обучении девочек и мальчиков быстро сокращается. Это важно, поскольку убеждение, будто гендер должен каким-то образом ограничивать жизненные шансы личности, отвратительно, а также в силу того, что обучение девочек в целом идет на пользу обществу. Женщины, получившие образование, имеют меньше детей и, следовательно, меньше шансов умереть во время родов и больше заинтересованы в трудовой занятости. Кроме того, они дают больше возможностей своим детям. Дети более образованных матерей имеют больше шансов родиться здоровыми, выжить в младенчестве и получить необходимые прививки. Они также проводят больше часов в неделю за учебой, успешнее сдают экзамены и в целом имеют более здоровые пищевые и жизненные привычки, одновременно отвергая вредные привычки (например, курение) [34].

В силу всех этих причин развивающиеся страны в последнее время прилагают много усилий в области женского образования и добиваются потрясающих результатов. С 1990 г. показатели женского начального образования выросли с 73 до > 87 %, а женского среднего образования с <40 до >61 % [35]. Здесь темпы прогресса также зависят от региона – в арабских государствах и Южной Азии процесс идет быстрее, в Центральной и Южной Африке медленнее, но все эти изменения направлены в положительную сторону. В настоящее время в половине развивающихся стран число девочек, обучающихся в школе, равно числу мальчиков, а в трети стран девочек даже больше. В некоторых странах скорость изменений превзошла все ожидания. Всего за десять лет в Марокко ситуация с зачислением женщин в учебные заведения достигла того уровня, на достижение которого США потребовалось почти полвека [36].

Как раз на высшей ступени, а именно в области высшего образования, были достигнуты самые быстрые и значительные успехи, в основном за счет его расширения в развивающихся гигантах – Китае и Индии. Во всем мире доля выпускников средних школ, поступающих в высшие учебные заведения, с 1990 до 2014 г. выросла более чем в два раза: с <14 до >33 % [37]. По нашим собственным оценкам, количество людей, получивших высшее образование, сегодня больше, чем общая сумма людей, получивших высшее образование за всю историю человечества до 1980 г. Каждый год к этой сумме прибавляются от 25 до 50 миллионов новых обладателей ученых степеней. Массовые открытые онлайн-курсы (МООК), такие как Khan Academy и Coursera, помогают еще быстрее увеличить эти показатели.

Хотя выше всего показатели охвата населения высшим образованием в развитых странах (74 % выпускников средней школы по сравнению с 23 % в развивающихся странах), с точки зрения статистики именно развивающиеся страны делают более заметные успехи [38]. Уже по крайней мере 40 % аспирантов естественных и инженерных наук в мире и 37 % дипломированных научных сотрудников проживают в развивающихся странах [39]. Женщины тоже быстро двигаются вперед. Начиная с 1970 г. количество мужчин, получивших среднее образование, возросло в четыре раза, а количество женщин, получивших среднее образование, – в семь раз, так что во всем мире сегодня, опять-таки впервые в истории, женщин, обучающихся в университетах, больше, чем мужчин [40].


Человечество стало более здоровым, богатым и образованным, чем когда-либо за всю свою историю. Успехи в развитии, которые мы сделали за последние несколько десятилетий, – это не просто постепенные улучшения в русле долгосрочных тенденций. Мы поставили рекорды, которые вряд ли когда-нибудь сможем побить и которые превращают этот момент в наш собственный золотой век. Его приметы: увеличение глобальной продолжительности жизни с 1960 г. почти на десять лет, радикальное сокращение бедности на фоне глобального роста населения, почти универсальная грамотность нынешнего поколения взрослых, численное превосходство женщин в области образования. Индивидуальный опыт может различаться. И массовые проблемы сохраняются. Некогда обеспеченные домохозяйства теперь изо всех сил борются за существование. Почти миллиард человек до сих пор живут меньше чем на два доллара в день. Но для большего числа людей в большем количестве мест, чем когда-либо ранее, настоящее время снова является лучшим временем для жизни.

Почему сейчас?

Мы выигрываем битву против болезней

Как и в эпоху предыдущего Ренессанса, ответ на этот вопрос в Новом Ренессансе начинается с сокращения болезней. Две главные угрозы человеческому благополучию – инфекционные заболевания (вызванные и распространяемые определенными бактериями, вирусами и другими паразитами) и хронические заболевания (долговременные болезненные состояния, такие как болезни сердца, рак и диабет, за появление которых отвечает комплекс причин, среди которых – образ жизни, питание, генетика и другие факторы). И те и другие заболевания оказались беспомощны против соединяющих и развивающих сил нашего времени. В борьбе с инфекциями эти силы дали нам усовершенствованные технологии и методы соблюдения гигиены, концепцию санитарно-эпидемиологического благополучия населения, чистую воду и централизованную борьбу с вредителями, вакцины, антибиотики и другие препараты, улучшенные сельскохозяйственные и основные зерновые культуры, обогащенные минералами и питательными веществами, рост государственного бюджета и частных доходов, которые можно инвестировать во все эти вещи, и, наконец, образование, позволяющее понимать их важность и разумно ими пользоваться.

В 1990 г. 13 миллионов детей в возрасте до пяти лет умерли от четырех основных видов инфекционных заболеваний: инфекция дыхательных путей (пневмония), диарея, туберкулез и другие болезни (корь, полиомиелит, коклюш, дифтерия и столбняк) [41]. Бо́льшая часть этих смертей пришлась на развивающиеся страны. В развитых странах дети почти не умирают от этих заболеваний.

В 2015 г. от этих инфекций умерли 5,9 миллиона детей. Неизмеримая трагедия была сокращена в два раза благодаря вакцинации, безопасной питьевой воде, распространению образования и изменению поведения [42]. Более широкое использование противозачаточных средств, возможность получить более качественный уход во время беременности и после родов, а также увеличение числа квалифицированного медицинского персонала позволили вдвое сократить долю матерей, умирающих в родах [43]; доля новорожденных с недостаточным весом также уменьшилась в два раза, с 29 % в 1990 г. до примерно 15 % сегодня, в первую очередь благодаря росту доходов и импорту сельскохозяйственных усовершенствований. В результате всего перечисленного сегодня ежедневно сохраняется на 19 тысяч больше детских жизней, чем в 1990 г., – и человечество ежегодно превосходит это замечательное достижение.

На другом конце жизни человека мы также добились заметных успехов, сумев усмирить хронические заболевания – болезни сердца и рак. В развитых странах вероятность смерти от той или иной формы сердечно-сосудистых заболеваний сегодня составляет менее половины от показателя 1960-х гг. [44]. Ученые поддерживают наше здоровье через распространение новых технологий, таких как препараты, снижающие уровень холестерина, и стенты, позволяющие расширять артерии без операции на открытом сердце. Не менее важную роль сыграло широкое распространение представлений о профилактике, которому мы все способствовали. Курение, некогда повсеместно распространенное, в настоящее время считается социальным недостатком. Общества Анонимных Алкоголиков распространились по всему миру. Люди потребляют меньше жира и больше занимаются спортом (или, по крайней мере, осведомлены о том, что им стоило бы это делать). Распространение полезных привычек резко сказывается на статистике глобальной смертности, отражающей два факта: во-первых, расстановка сил в борьбе с хроническими заболеваниями изменилась еще до того, как стали доступными нужные лекарства и хирургические процедуры, и, во-вторых, те страны, где преимущества профилактики игнорируются, по-прежнему проигрывают борьбу с болезнями, несмотря на новые медицинские технологии [45]. В России, где граждане (особенно мужчины) зачастую отмахиваются от доказательств вреда алкоголя и курения, средняя продолжительность жизни в настоящее время (66 лет)[14] примерно на 3 года ниже, чем была в 1960-е гг., и примерно на 13 лет ниже, чем сегодня в Северной Америке и странах Европы [46].

Достигнутое человечеством замечательное падение детской смертности плюс прогресс в предотвращении и лечении хронических заболеваний составляют причину, по которой в период между 1950 и 2005 гг. население продемонстрировало самый быстрый прирост в истории – и, если демографические прогнозы верны, подобное никогда не повторится в истории нашего вида.

Этот последний в истории демографический взрыв уже принес огромные дивиденды в Восточной Азии (в основном в Китае) и Южной Азии (в основном в Индии) и постепенно начинает приносить дивиденды в Африке. Не так давно специалисты по экономике развития были убеждены, что быстрый рост населения будет иметь исключительно негативные последствия. В 1972 г. некоммерческий научный центр «Римский клуб» опубликовал ставший знаменитым доклад «Пределы роста», в котором было предсказано опустошение экосистем в результате загрязнения, истощение природных ресурсов и в конечном счете социальный коллапс. Но к 1990 г. мы оценили то, что ранее обнаружили люди предыдущего Ренессанса: всплеск роста населения может иметь положительные последствия. «Люди – настоящее богатство нации» – так начинается «Доклад о развитии человека» Всемирного банка от 1990 г. Действительно, чем больше население, тем больше затрат требуется на его обеспечение и питание. И действительно, у планеты есть свои пределы. Но каждый новый рот обладает двумя руками и мозгом. До тех пор пока нам для существования хватает пищи (опасность, которую предыдущий Ренессанс предупредил, введя в сельскохозяйственный оборот больше земель, а мы решили путем удвоения мирового производства фермерской продукции за счет улучшения ирригации, разработки новых удобрений и повышения всхожести семян), преимущества – больше рабочих рук и больше интеллектуальных ресурсов – будут перевешивать затраты [47]. Эта логика справедлива в особенности в условиях открытой экономической среды с налаженными связями, где обилие работы превращается в торговое преимущество и уверенный рост благосостояния.


Мы пожинаем плоды международных экономических связей

Однако более прочные экономические связи не означают автоматического увеличения благосостояния. И если в одних случаях мы видели, как эти связи работают, то на примере других убедились, что неблагоприятные факторы (неравенство возможностей, недобросовестное правительство и разного рода потрясения) могут их разрушить.

Эти предостережения важны – и, как мы увидим позже, они часто способствуют тому, что успехи, достигнутые наверху, опережают успехи, достигнутые внизу, – но они не отменяют того, что развитие глобальной торговли и финансов во многих смыслах помогло сократить уровень бедности, обеспечить благополучие и спонсировало улучшения в системе здравоохранения и образования.

Во-первых, расширение торговли создает рабочие места и повышает доходы для бедных слоев населения, увеличивая размеры и стабильность рынка сбыта продукции за пределами ограниченного и циклически развивающегося спроса на местных рынках. Это преимущество справедливо для товаров мелкосерийного трудоемкого производства – для него множество незанятых рук составляют более серьезную конкуренцию, чем для крупномасштабных капиталоемких отраслей промышленности, для работы в которых требуется лишь несколько высококвалифицированных специалистов [48].

В эпоху Возрождения доходы крестьян повысились, когда в межсезонье они начали открывать прядильные мастерские и сбывать свою продукцию на отдаленных рынках. Это не так сильно отличается от того, что произошло в конце 1980-х и начале 1990-х гг., когда Вьетнам заявил о себе как о главном мировом производителе риса. В течение одного года (1987–1988) Вьетнам преобразился из импортера риса во второго по величине в мире экспортера и с тех пор только расширяет экспорт (с 1,5 миллиона тонн в 1990 г. до около 7 миллионов тонн в 2014 г.). Одновременно с этим в сельских областях страны улучшилось питание, было создано 7,2 миллиона новых рабочих мест, а у мелких фермеров появился новый источник дохода (который в 2013 г. принес им 3 миллиарда долларов) [49]. Еще один недавний пример – Бангладеш, где была построена экспортоориентированная швейная индустрия с оборотом 23 миллиарда долларов, к 2015 г. обеспечивавшая >80 % общего объема экспорта страны, в которой было занято более 4 миллионов человек [50]. Да, заработная плата и условия труда в этом секторе вызывают ужас, но они улучшаются (в 2013 г. правительство повысило минимальный размер оплаты труда для работников швейной промышленности на 77 %) [51]. Вынужденные выбирать между крайней бедностью и просто бедностью, многие жители Бангладеша выбирают последнее [52].

Во-вторых, новые экономические связи способствуют развитию конкуренции. В зависимости от того, какие условия существовали раньше (особенно если это была монополия), конкуренция помогает расширить ассортимент товаров и услуг, улучшить качество и снизить цены. Это значит, что ограниченный бюджет домохозяйства можно растянуть еще немного, а малые предприятия получают более благоприятные условия для работы. В эпоху Возрождения дешевое зерно, ввозимое в Европу из стран Балтии, помогло снизить цены на хлеб. Сегодня глобальная торговля пшеницей, рисом и другими зерновыми культурами помогает контролировать стоимость основных продуктов питания по всему миру.

Новые связи повышают производительность. Человек, сидящий за швейной машинкой, за один час сошьет больше рубашек, чем человек, вооруженный только иголкой и ниткой. Чтобы выразить эту разницу, экономисты используют термин «производительность». Это важно для благосостояния людей, поскольку чем больше мы можем сделать в час, тем более ценен этот час для других и тем более высокой платы за работу (и, следовательно, более высоких доходов) мы можем ожидать.

Подключение к глобальной экономике повышает нашу производительность через разные каналы. Самый простой из них – специализация. По мере расширения и укрепления торговых связей в эпоху Возрождения некоторые крестьяне начали специализироваться на выращивании винограда вместо зерна. Они продавали виноград (выручая за него больше, чем могли бы выручить за зерно), тратили часть доходов на зерно, необходимое для собственного пропитания, а остальное клали в карман.

Сегодня специализация все еще является одним из слагаемых повышения производительности посредством торговли (как показывает пример Вьетнама), но это только часть общей картины. Еще один важный способ – техническая модернизация. Новые машины внедряют новые технологии, требующие развития у пользователей новых навыков. Тайвань, небольшой бедный ресурсами остров, вырастил с 1980 г. промышленный сектор с оборотом 180 миллиардов долларов, в основу которого легли иностранные технологии [53]. То же самое сделала Южная Корея, чей производственный сектор сегодня в два раза превышает тайваньский. Технологии, заимствованные из США и Японии в середине 1980-х гг., помогли Южной Корее основать производство новейших полупроводников [54]. В 2013 г. южнокорейская полупроводниковая промышленность обогнала японскую и вышла на второе место в мире [55].

И наконец, более прочные экономические связи вносят заметные положительные изменения в саму природу труда и структуру рабочей силы. В эпоху Возрождения зарождающееся сельское ремесленное и текстильное производство было благом не только для мужчин, временно оставшихся не у дел, но и для женщин, детей и стариков, которые получили новый шанс работать и улучшить свое материальное положение. Аналогичным образом экономическая открытость сегодня помогает женщинам перейти из сельскохозяйственного в производственный и обслуживающий сектор и положительно влияет на их образование, здоровье, доходы и профессиональное развитие [56].


Мы пожинаем плоды связей между людьми

Расширение контактов между людьми также положительно сказалось на росте человеческого благополучия.

Людям, которым не повезло родиться в странах с высокими темпами роста экономики, миграция предлагает возможность внести вклад в рост благосостояния других государств. Переехав из страны с низким экономическим ростом в страну с высокими темпами роста или из менее развитого в более развитый регион, люди всех степеней квалификации и образования получают возможность зарабатывать больше за равноценный труд.

Мигранты не просто кладут эту разницу в карман – многие отправляют часть заработка домой. Миграция – это улица с двусторонним движением. Люди приносят в страну себя, свой труд и свои навыки, а в другую сторону отправляют наличные деньги. Эта неофициальная финансовая поддержка выросла почти в двадцать раз по сравнению с 1990 г. В 2016 г. общий объем частных денежных переводов, полученных развивающимися странами, составил, согласно оценкам экспертов, более полутриллиона долларов [57]. Это в три с половиной раза превышает размеры официальной (иностранной) помощи на развитие, которую эти страны ежегодно получают от правительств других стран. И, хотя эти суммы нельзя сравнить с потоком иностранных инвестиций, они обычно поступают в те места, куда инвестиции не доходят, и оказывают намного более надежную поддержку. Спекулятивные инвесторы могут отозвать деньги из одной страны и направить их в другую в зависимости от того, чьи возможности кажутся им более многообещающими в этот год или в этот час. Денежные переводы посылают оставшимся на родине семьям. Когда на страну обрушивается кризис, частные денежные переводы, как правило, растут, в то время как иностранные инвестиции сокращаются.


Приток капитала в развивающиеся страны, 1990–2014

Эпоха открытий

Потоки денежных переводов превышают иностранную помощь и отличаются большей стабильностью, чем иностранные инвестиции

World Bank Databank (2015). World Development Indicators. По материалам data.worldbank.org; Оценки денежных переводов по материалам World Bank (2015, 13 April). Migration and Development Brief 24


Отток квалифицированных специалистов, особенно в сфере медицины, часто критикуют как «утечку мозгов». Около 95 % медсестер и 60 % врачей Гаити уезжают в поисках работы в страны с более высоким уровнем дохода – это крайний, но далеко не единственный случай [58]. Несомненно, масштабный отток врачей и других специалистов не лучшим образом отражается на положении дел внутри страны, и попытки создать для квалифицированных специалистов достаточно стимулов, чтобы остаться дома, являются предметом активных политических экспериментов от Таиланда до Танзании. Тем не менее совокупность доказательств говорит о том, что выгоды эмиграции в долгосрочной перспективе перевешивают издержки. Например, Филиппины являются одним из крупнейших в мире экспортеров медсестер, а также демонстрируют в рамках национальной системы здравоохранения один из лучших примеров соотношения количества медсестер и пациентов. Местные стимулы и обучающие программы создают достаточное количество предложений, чтобы обслуживать оба рынка.

Миграция явно благотворно сказывается и на росте благосостояния жителей принимающих стран. Опасения, что иммигранты захватывают рабочие места и создают непосильную нагрузку на социальные службы, преувеличены. Мужество, целеустремленность и компетентность объединяют тех людей, которые успешно преодолевает все препятствия на пути к большому городу или новой стране. Приезжие в совокупности платят больше налогов, чем стоят те услуги, которые они потребляют. Они часто берут на себя работу, которую не могут (медсестры) или не хотят (помощники по хозяйству) выполнять трудовые кадры в принимающей стране. И они помогают установить между принимающей страной и своим домом более прочные связи, которые могут стать основой для бизнеса. Возьмите тайваньскую и израильскую диаспоры, которые в обоих случаях помогли построить процветающее высокотехнологичное производство на обоих концах миграции. Эти связи способствуют развитию более космополитичной политики. Когда в 2014 г. Россия присоединила Крым, особенно громко протестовала Канада – отчасти потому, что 1,3 миллиона канадцев, по собственному утверждению, имеют украинские корни [59].


Мы пожинаем плоды соединения идей

Конечным звеном между новым миром, в котором мы живем, и новыми высотами человеческого развития, которых мы достигли, является распространение идей. Иногда эти идеи принимают форму практического знания, которое пронизывает все соединительные силы, описанные выше. Его влияние на развитие так велико, потому что после того, как знание получено (часто ценой больших усилий и затрат), стоимость его распространения равняется практически нулю. И, в отличие от других товаров, чем больше людей потребляют знание, тем больше знаний возникает для дальнейшего потребления. И что самое замечательное, в какой бы форме ни существовало знание – в виде новых устройств, лекарств или вакцин или в виде ряда политических мер, – приняв его, менее развитые общества могут перепрыгнуть те годы или десятилетия, которые привели к получению этого знания, и воспользоваться его преимуществами безотлагательно [60].


Продолжительность жизни при рождении относительно ВВП на душу населения, 1960 г. и 2014 г. (каждая точка – это страна)

Эпоха открытий

Распространение новых идей и технологий означает, что при любом уровне дохода дети, рожденные сегодня, живут дольше

World Bank Databank (2015). World Development Indicators. По материалам data.worldbank.org; адаптировано, с благодарностью авторов за его щедрый вклад в эту тему, на основе: Angus Deaton (2013). The Great Escape: Health, Wealth, and the Origins of Inequality. Princeton, NJ: Princeton University Press


Эти преимущества наглядно отражены в статистике развития. Так называемая кривая Престона (по имени экономиста, который первым нарисовал ее в 1975 г.) на графике показывает, что по мере повышения доходов населения продолжительность жизни также повышается: у людей с более низким уровнем дохода положительные изменения более заметны, у людей с высоким уровнем дохода результаты более скромные. Но со временем вся кривая смещается вверх, и, таким образом, при любом уровне доходов продолжительность жизни сегодня выше, чем в 1960 г. Почему мы родились на другой кривой, а не на той же, где родились наши родители? Ответ: потому что изменилась среда знаний.

Распространяющиеся идеи могут быть положительными не потому, что они позволяют нам достичь какой-то практической цели, а в более широком смысле потому что они меняют наши представления о достойной жизни. Мы называем такие идеи ценностями. Демократия, впечатляющее распространение которой в последнюю четверть века было затронуто в главе 1, является здесь наиболее важным примером. Возвращаясь к Аристотелю, одна из главнейших идей цивилизации состоит в том, что участие в политической жизни представляет уникальную способность человека и что хорошее общество – это то, которое дает каждому возможность развивать и свободно выражать свои политические взгляды. Специалисты по экономике развития, в частности Амартия Сен, подкрепили эту философскую точку зрения практическими наблюдениями, указав на то, что, согласно эмпирическим фактам, при демократии, как правило, принимается меньше катастрофичных для собственного народа политических решений по сравнению с другими формами правления.

Распространение демократии также имеет большое значение для глобального благосостояния людей, поскольку оно способствует установлению стабильности. Как и пятьсот лет назад, войны крайне отрицательно сказываются на развитии. Насилие выгоняет людей из домов, лишает семьи кормильцев, а детей – родителей, приводит к массовым случаям физической и психической недееспособности. Сегодня 70 % случаев младенческой смертности и почти 80 % детей, не посещающих школу, сосредоточены в пострадавших от конфликтов государствах [61]. Когда начинается война, страны теряют десятилетия прогресса.

Демократические государства редко воюют друг с другом. Хотя справедливость этого утверждения целиком зависит от того, какой смысл вы вкладываете в понятия «демократия» и «война», не вызывает сомнений, что с тех пор, как доля мирового населения, проживающего при формальной демократии, выросла, общее количество крупных межгосударственных конфликтов упало примерно на 60 % от своего пика в конце холодной войны [62]. Демократия зарекомендовала себя как лучший способ решения внутренних споров. Военные перевороты почти прекратились в Латинской Америке (пережившей 30 подобных случаев между 1970 и 1989 гг. и только 3 после этого периода) и стали гораздо менее частыми в Африке (где в 1990-х гг. произошло 15 переворотов, но после 2000 г. – только 5) – легитимность такого рода действий во всем мире снижается [63]. До начала гражданской войны в Сирии в 2011 г. число погибших в результате гражданских войн в XXI в. (около 40 тысяч в год) составляло только четверть от потерь, зарегистрированных в 1980-х гг. (более 160 тысяч в год) [64]. И хотя СМИ часто искажают наше восприятие этого факта, на самом деле количество насилия в мире уменьшилось. Это произошло не в последнюю очередь благодаря распространению таких идей, как демократия (а также права человека, международное правосудие и другие связанные с ними нормы).

Ржавые пятна золотого века

Изобретатель линейной перспективы Филиппо Брунеллески (1377–1446) учил: то, что мы видим, зависит от того, как мы на это смотрим. То же самое можно сказать о достижениях предыдущего и нынешнего Нового Ренессанса. С лицевой стороны все выглядит положительно, но при взгляде на изнанку возникают вопросы. Прогресс раскалывает общество на два полюса. Одни народы движутся вперед огромными шагами, другие – безнадежно отстают уже потому, что стоят на месте. Чем быстрее прогресс, тем настоятельнее необходимость смотреть по сторонам и видеть полную картину.


Отставание

В эпоху Возрождения поляризационный эффект прогресса был очевиден. В этот период благосостояние людей в среднем росло, но противоположные полюса общества, богатые и бедные, все больше отдалялись друг от друга. Это был, по словам английского историка У. Дж. Хоскинса, «золотой век для стригалей… [которые] оставляли остриженным лишь клочок шерсти на спине, чтобы укрыться от холода, и то не всегда» [65].

Крестьяне, которые смогли обратить новые обстоятельства себе на пользу, добились больших успехов. Те, кому это не удалось, справлялись хуже. Их земельные участки со временем уменьшались. Земельные наделы, которых когда-то было достаточно, чтобы обеспечить пропитание крестьянской семьи, понемногу дробились и рассеивались: передавались частями по наследству, переходили по решению суда (часто подкупленного) в руки дворян, стремившихся консолидировать свои территории, изымались за долги, в которых крестьянские семьи погрязали из-за болезней, неурожаев, краж или войн. Для крестьянства путь от невыплаченного долга до лишения права на землю был весьма коротким и хорошо изученным. Конкуренция со стороны более дешевого импортного зерна, которое привозили морским путем из стран Балтики, лишь усугубляла их положение.

В городах обстоятельства также складывались не в пользу нижней части экономической пирамиды. Данные того периода разнородны, но все доступные примеры доказывают, что начиная примерно с 1450 г. и далее, по мере расширения торговли и появления новых способов производства, разрыв между богатыми и бедными увеличивался. К 1550 г. почти во всех больших западноевропейских городах 5–10 % наиболее состоятельных граждан принадлежало от 40 до 50 % общего объема богатств, в то время как менее состоятельные 50 % граждан могли распоряжаться лишь собственным трудом. В графстве Саффолк, Англия (в то время одном из самых «индустриальных» регионов Европы), только 1,5 % населения владели половиной всех богатств региона, в то время как менее состоятельной половине населения принадлежало лишь 4 %, причем 80 % населения жили за чертой бедности или близко к ней [66].

Основной причиной такого положения вещей было падение реальных заработков в нижней части шкалы распределения доходов. Постоянный приток обедневших селян позволял поддерживать в городах низкую оплату труда, особенно среди неквалифицированных работников. Городские производители, передававшие часть работы наемным работникам в сельской местности, ловко уклонялись от соблюдения правил и не позволяли крестьянам диктовать свои условия, как это было с городскими гильдиями. Хуже всего приходилось женщинам. Между 1480 и 1562 гг. оплата труда женщины, присматривавшей за детьми, не увеличилась, однако стоимость ежедневных предметов первой необходимости за тот же период выросла на 150 % [67].


Регресс

Увеличивающийся разрыв между богатыми и бедными был обусловлен не только относительной скоростью продвижения вперед. Иногда бедные слои населения переживали регресс. Потрясения, о которых пойдет речь в главе 6, отражались на бедных гораздо тяжелее, чем на богатых. Череда неурожаев в Европе в 1520-е гг. означала для многих крестьян долги и в конечном счете лишение права собственности на землю. Не менее опасными могли оказаться местные колебания рыночного спроса или потребительских вкусов. У крестьян, выращивавших зерно, по крайней мере, всегда была какая-то пища. Крестьяне, решившие выращивать прибыльные товарные культуры, такие как виноград, могли столкнуться с угрозой голода, если торговля внезапно сворачивалась, что часто происходило, когда в соседних областях вспыхивали эпидемии или военные конфликты [68]. А конфликтов было достаточно (см. главу 7).

Все это время население продолжало расти. В течение многих десятилетий восстановление населения имело положительные последствия для бедных слоев населения, так как рост количества рабочей силы способствовал росту производства продуктов питания и повышению спроса на промышленные товары. Но в конце концов цифры обернулись против них. В 1450 г. трудоспособный мужчина в Западной Европе вряд ли мог остаться без работы. К 1550 г. безработица среди молодежи стала обычным явлением, что опять же способствовало сохранению низкой оплаты труда в городах, одновременно увеличивая спрос на жилье, а в сельской местности давало помещикам возможность взвинчивать плату для арендаторов [69].

Увеличение разрыва между богатыми и бедными высветило границы высокоморального гуманизма того периода. Многие гуманисты воспевали Человека с большой буквы, но при этом игнорировали бедственное положение обычных людей. Программы помощи зачастую были продиктованы не столько искренним желанием помочь бедноте, сколько стремлением избавить улицы от ее неприглядного присутствия. Во многих городах в качестве помощи бедным предлагали в основном низкооплачиваемую работу. В Венеции после 1529 г. нищих отправляли работать на корабли за половину обычной платы. Начиная с 1536 г. английские «Законы о бедных» предписывали детям получателей социальной помощи работать без оплаты на других фермеров или ремесленников. Закон, принятый в Лёвене в 1541 г., требовал, чтобы безработные собирались два раза в день в мэрии с инструментами в руках, иначе их имена вычеркивались из списков социального обеспечения. Те, кто вводил эти правила, утверждали, что тяжелый труд благотворно влияет на души бедняков, но для работодателей они имели удобный побочный эффект – возможность сохранять низкую оплату труда неквалифицированной рабочей силы.


Географический разрыв

Ренессанс был европейским феноменом, причем строго западным. В Западной Европе север (с его более прочными торговыми связями) начал постепенно обгонять юг, а Атлантический регион обгонял Средиземноморье (по той же причине) [70]. Восточная Европа оставалась в основном сельскохозяйственной, и крестьяне там ощущали не облегчение, а, наоборот, усиление феодального гнета. В Азии с общеэкономической точки зрения в этот период не происходило заметных изменений.

Вместе с тем другие континенты пережили регресс. В Африке в 1450–1500 гг. были порабощены около 150 тысяч человек, а в следующие сто лет это число возросло до полутора миллионов [71], в то время как в Северной и Южной Америке европейская эпоха Великих географических открытий ознаменовала коллапс ранее существовавших цивилизаций. Обмен с Европой действительно принес коренным жителям Америки некоторые выгоды. Европейцы привезли с собой новые сельскохозяйственные культуры: пшеницу из Европы, рис и сахарный тростник из Азии, оливки из Леванта, кофе из Африки. Они привезли новых животных: одомашненный крупный рогатый скот, овец, свиней, кур, коз и тягловый скот. Они привезли новые технологии: парусники, металлические инструменты и оружие, плуги. Они даже заново изобрели колесо – цивилизациям Мезоамерики колесо было известно примерно с 1500 г. до н. э., но оно оставалось всего лишь игрушкой, поскольку не было достаточно крупных одомашненных животных, которых можно было бы запрячь в телегу.

Однако негативные последствия – болезни, разграбление и порабощение – безусловно, затмили позитивные, до наслаждения плодами которых дожило поразительно мало коренных американцев. Тысячелетие обмена между Европой, Африкой и Азией способствовало созданию на этих континентах так называемых «вирусных резервуаров». Смешение различных биологических компонентов породило величайших убийц в истории – «черную смерть» и другие болезни, – а также позволило выработать иммунитет против них. Америка пережила эти смертоносные волны в благодатном карантине, но прибытие европейских исследователей и завоевателей познакомило коренное население с тысячелетними концентрированными ужасами природы. Оспа, корь, грипп и тиф, принесенные европейцами (плюс желтая лихорадка и малярия, носителями которых были африканские рабы), уничтожили почти все население Гаити, сократив его численность с нескольких миллионов до нескольких сотен, и убили от 90 до 95 % ацтекского (Мексика) и инкского (Перу) населения (численность которого сократилась по меньшей мере с 20 миллионов до >1 миллиона и с 9 миллионов до 600 тысяч соответственно) [72]. После того как болезни уничтожили бо́льшую часть коренного населения Америки, а оставшиеся в живых были убиты или порабощены с помощью оружия, европейские империи заявили права на их богатства – золото, серебро и пахотные земли. С 1500 г. и далее, по крайней мере в течение трех веков, Северная и Южная Америка поставляли 85 % мирового серебра и 70 % золота [73].

Новые пятна

Если говорить о нашем нынешнем росте, введенное Брунеллески понятие перспективы по-прежнему актуально: то, что вы видите, зависит от вашего угла зрения.

Сделайте шаг назад и посмотрите на человечество издали, и вы увидите в целом позитивную картину. Формирующийся глобальный средний класс – средняя треть человечества с точки зрения доходов – пережил повышение реальных доходов на 60–70 % по сравнению с 1988 г. Доходы наименее состоятельной трети населения выросли на 40 % [74]. Но сравните судьбы мировой верхушки и мирового дна, и вам откроется совсем другая картина. В то время как в среднем глобальное благосостояние улучшилось, крайние точки отошли еще дальше друг от друга, и сегодня разница между высшими и низшими слоями общества продолжает расти. В 2010 г. в руках у 388 миллиардеров мира было сосредоточено больше средств, чем имела вся вторая (менее состоятельная) половина человечества. В 2015 г. эти богатства находились под контролем всего 62 человек [75]. Менее состоятельная половина мирового населения – 3,6 миллиарда человек – живет в среднем всего на несколько долларов в день. К ним относятся 2,5 миллиарда человек, живущих в антисанитарных условиях, 1,3 миллиарда человек, живущих без электричества, и 800 миллионов человек, которым хронически не хватает пищи [76]. В этой половине сосредоточены 99 % всех случаев детской смертности, 80 % всех случаев смерти от хронических заболеваний и 75 % всех случаев смерти от инфекционных заболеваний [77].

Сделайте шаг вперед, разделите человечество на страны, и картина снова изменится. Сравнивая страны, первое, что мы замечаем, – это позитивное явление, которое экономисты называют конвергенцией [78]. В совокупности за прошедшую четверть века средний доход в более бедных, развивающихся странах почти сравнялся со средним доходом в более богатых странах с развитой экономикой, и это произошло довольно быстро. Начиная с 2000 г. 50 стран демонстрируют более чем 3,5-процентный прирост доходов на душу населения в течение десяти лет или более, а число стран, классифицированных как страны с «низким доходом» по стандартам Всемирного банка, уменьшилось в два раза, с >65 % до 33 % [79]. Эти эмпирические свидетельства подтверждают интуитивно понятное явление: менее развитые страны, которые только начинают заводить двигатели прогресса (то есть развивать базовую инфраструктуру, образование и здравоохранение), будут демонстрировать в этой области больше успехов, чем зрелые страны, у которых все это уже есть.

Некоторые серьезные оговорки портят общее впечатление. Это касается как людей, так и государств: уровень благосостояния мировой верхушки и мировых низов разительно отличается. С 1990 г. средний доход в двадцати самых бедных странах мира поднялся примерно на 30 %, в конкретных цифрах: примерно с 270 до 350 долларов, то есть вырос на 80 долларов. Доход в 27 самых богатых странах также возрос примерно на 30 % – с 36 до 44 тысяч долларов, то есть увеличился на 8000 долларов [80].

То, в какой стране вы родились, до сих пор во многом определяет, какая жизнь вас ждет. Если вы европеец, вы будете в среднем на 20–23 сантиметра выше (хороший обобщающий показатель здоровья нескольких поколений), чем житель Центральной Америки или Южной Азии [81]. Если вы родились в Нигере, ваша жизнь будет на 26 лет короче и вы потратите на учебу на 9 лет меньше, чем житель Дании [82]. Кроме того, у вас будет гораздо больше шансов стать очевидцем и участником военного переворота, гражданской войны или другого конфликта, в котором вас могут убить, искалечить, изнасиловать, лишить родных и/или крыши над головой.

И наконец, сделайте еще шаг вперед, чтобы посмотреть на внутреннее положение каждой страны, и картина снова станет неоднородной. Почти во всех странах, от наименее до наиболее развитых, разрыв между богатыми и бедными за последние несколько десятилетий увеличился [83]. Нигерия, в настоящее время самая крупная экономическая держава Африки, демонстрирует также один из самых впечатляющих примеров экономического неравенства в мире. За последние два десятилетия валовый доход Нигерии в реальном выражении на душу населения увеличился почти в два раза. Поразительно, но доля нигерийцев, живущих в нищете, за это время также удвоилась (с >30 % до >60 %) [84]. В США у 20 % наиболее состоятельных граждан реальные доходы выросли более чем на 25 % с 1990 г., у 20 % наименее состоятельных граждан доходы упали на 5 % [85]. 20 % наименее состоятельных граждан зарабатывали больше в те времена, когда в экономике США доход на душу населения был на 40 % меньше. Даже в европейских странах, давно известных экономическим равенством, таких как Дания, Германия и Швеция, богатые все больше отдаляются от основной массы граждан [86]. И это не только статистическое, но и пространственное разделение. Не только страна, но и местность, в которой вы родились, может определить качество вашей жизни. Жители престижных районов Оксфорда, Англия, могут рассчитывать прожить на 15 лет дольше, чем те, кто родился в более бедных районах города, – а вероятность того, что они отправят своих детей учиться в одноименном университете, гораздо выше.


Отстающие страны

Отставание и регресс остаются двумя основными факторами, влияющими на разницу в благосостоянии стран.

Первый фактор заключает в себе множество различий, особенно тех, которые зависят от развития технологий, торговли и инвестиций. Теоретически поделиться новой идеей ничего не стоит, но на практике распространение новой идеи может обойтись довольно дорого. Обычно это требует непосредственных затрат – например покупки или лицензирования новых технологий, но нередко затраты являются косвенными – к ним относится, например, обучение граждан использованию новых технологий. Во всем мире правительства тратят в среднем по 4600 долларов на одного ученика в системе государственного образования – в странах Центральной и Южной Африки этот показатель равняется всего 185 долларам, и это притом что по сравнению с 1990 г. он вырос на 15 % [87]. Недостаток финансирования тормозит все процессы – от распространения научных данных о вреде курения до сберегательных счетов, от полупроводников до представлений о равенстве женщин и мужчин. Страны, имеющие хорошую систему образования и промышленность, проводящие много собственных исследований и выделяющие средства на создание поддерживающей инфраструктуры, могут внедрить использование новых технологий и идей гораздо быстрее, чем страны, где такие условия отсутствуют[15].

Самый наглядный сегодняшний пример – неравенство в освоении цифровой сферы и его крупные социальные последствия. Интернет и мобильные технологии помогают преодолеть барьеры на пути к информации, образованию и коммуникации. Телекоммуникационная инфраструктура сегодня больше, чем любые другие технологии, представляет собой прогресс.

Но ее доступность не для всех одинакова. Международный союз по телекоммуникациям (МСТ) составил рейтинг более чем 150 стран согласно уровню развития в них телекоммуникационной инфраструктуры, включая стационарную и мобильную телефонию, домашний доступ к компьютеру и интернету, а также проводную и беспроводную широкополосную связь. Все 20 стран, занимающих первые строчки в этом рейтинге, находятся в Европе, Северной Америке и богатых регионах Юго-Восточной Азии и обладают неограниченным интернет-трафиком и повсеместным распространением широкополосного интернета, а количество абонентов мобильной связи в них превышает количество жителей. По другую сторону цифрового барьера в 20 странах, занимающих нижние строчки (все они находятся в Африке), по-прежнему существует лишь ограниченный (в основном коммутируемый) доступ в интернет, мало пользователей, слабо распространена беспроводная широкополосная связь, а доступ к международным массивам данных крайне ограничен. В целом, по данным МСТ, существует 39 «наименее подключенных стран», соответствующих этому описанию, в которых проживает до 2,4 миллиарда человек [88]. (Возможно, вскоре инновационные решения, такие как беспилотные самолеты Facebook на солнечных батареях и высотные воздушные шары Google, смогут помочь Африке заполнить некоторые из этих пробелов.)

Отставание стран в области торговли и инвестиций более противоречиво, хотя логически вытекает из сказанного выше. Классическая экономическая теория учит, что все страны получают выгоду от более открытой торговли (поскольку каждая из них может сосредоточиться на том, что удается ей лучше всего, и предложить это для обмена остальным участникам), однако в реальности все выглядит отнюдь не так просто [89]. Когда препятствия на пути потока капитала, людей, идей и товаров исчезают, недостатки одной страны по сравнению с другой порой становятся просто вопиющими. Преимущества торговли не просто просачиваются, как ручейки из тающего на вершине горы снега, чтобы принести каждому то, что ему нужно. Скорее они стекаются в те страны и города, которые изначально обладают преимуществами.

Некоторые из этих преимуществ возникают естественным образом. Например, Сингапур обладает выгодным положением и глубокими гаванями, которые делают его идеальным торговым центром Азии. Другие преимущества создаются руками человека. Ямайка, еще одно островное государство, имеет даже больше естественных преимуществ, чем Сингапур: более обильные и прибыльные природные ресурсы, близость к крупному открытому рынку и гораздо более привлекательные пляжи. В 1960 г. эти два острова имели сопоставимый уровень ВВП на душу населения. С тех пор сингапурский ВВП на душу населения взлетел выше, чем в Соединенных Штатах, в то время как ямайский реальный ВВП более пятидесяти лет оставался неизменным. Детская смертность на Ямайке сегодня в восемь раз выше, чем в Сингапуре. Статистика убийств и изнасилований на Ямайке одна из самых высоких в мире, в то время как в Сингапуре она одна из самых низких. Разница заключается в том, что Сингапур предпринял политические меры для привлечения инвестиций и высококвалифицированных специалистов и выстроил систему образования, транспорта и энергетики, а также IT-инфраструктуру мирового класса. Ямайка этого не сделала.

Географическое положение, ресурсы, количество рабочей силы и квалифицированных специалистов, инфраструктура, выбор государственной политики, качество юридических и финансовых учреждений, предрассудки, касающиеся расы или пола, – все это гораздо сложнее анализировать, чем тарифные ставки. Вот почему, несмотря на резкое сокращение глобальных торговых барьеров в течение последних двух десятилетий, сегодня всего 10 стран обеспечивают 60 % всей мировой торговли в стоимостном выражении, а 60 стран обеспечивают 92 %. Некоторые страны Африки фактически скатились на более примитивные ступени экономического развития (сокращение собственного производства, более активная добыча полезных ископаемых), после того как деньги и промышленность перекочевали в другие (более готовые для бизнеса) страны Африки и Азии [90]. Международный валютный фонд когда-то поставил обязательным условием финансовой помощи бедным странам открытие их промышленности для иностранных инвестиций и конкуренции. Сегодня он неохотно признает, что было безрассудством требовать этого от стран, где еще не существовало политической и социальной инфраструктуры, которая позволила бы им участвовать в конкуренции на равных[16].


Отстающие граждане

Экономические преобразования в эпоху Возрождения – развитие сельских областей, переход от феодальной зависимости к наемному труду в сельском хозяйстве, расширение конкуренции в международной торговле зерном и товарами – способствовали успеху хорошо подготовленных граждан и заставили тех, кто оказался в неблагоприятном положении, прикладывать еще больше усилий, чтобы не отставать. То же самое происходит с людьми сегодня. Падение торговых и инвестиционных барьеров позволило перенести трудоемкое производство в те страны, где оно ниже оплачивается. Технологический прогресс, особенно в области вычислительной техники и робототехники, сделал возможной замену рабочих машинами. (По удачному совпадению, слово «робот» произошло от славянского слова, в XIV–XV вв. означавшего часть недели, обычно от двух до четырех дней, когда крестьянин бесплатно работал на своего господина [91].) Обе эти тенденции увеличили прибыли для владельцев и инвесторов и подняли заработную плату для тех, кто обладал управленческими и техническими навыками, вписывающимися в новую динамику. Но они снизили доходы тех наемных работников, чьи рабочие места перешли в офшор или были заняты машинами. Одним словом, отмена экономических барьеров увеличила доходы квалифицированных работников и увеличила разрыв в оплате труда между более и менее образованными кадрами [92].


Регресс

Добросовестное правительство может помочь отстающим быстро догнать тех, кто вырвался вперед (как это произошло в Китае, Гане, Сингапуре и многих других странах). Но внезапные незапланированные шаги назад – социальные, экономические, экологические, биологические и военные потрясения – могут уничтожить достижения даже самых эффективных программ развития. Такие потрясения происходят все чаще. Из десяти наиболее смертоносных стихийных бедствий с 1980 г. восемь произошли после 2002 г. [93]. В наши дни, как и пятьсот лет назад, эти потрясения сильнее всего бьют по малообеспеченному населению. Бедные люди и бедные страны остаются наиболее беззащитными перед стихийными бедствиями и войнами (в развивающихся странах разворачиваются 10 крупнейших военных конфликтов современности, они же служат источником 86 % общего числа (20 миллионов) беженцев в мире) [94], а также перед новыми опасностями, о которых пойдет речь в главе 6. У них не хватает средств, чтобы принять профилактические меры – изучить новые технологии, организовать запасы продуктов питания и топлива, соорудить дамбу или подготовить государственных служащих для помощи населению при стихийных бедствиях, – которые могли бы снизить их уязвимость. У них нет средств на ликвидацию последствий стихийного бедствия – восстановление дорог, школ и больниц. И им недостает средств, чтобы поддержать население, наладив выплату пособий по безработице, организовав удовлетворительную систему здравоохранения, пенсионного обеспечения и хранения частных сбережений. В развитых странах ВИЧ/СПИД считается хроническим, но поддающимся контролю заболеванием. В большинстве стран Центральной и Южной Африки это экономическая и социальная катастрофа. Людей, которые уже испытывают трудности с поиском пропитания, потрясения лишают возможности учиться и работать, загоняют их в нищету, толкают к преступной деятельности, злоупотреблениям, этническому насилию, самоубийствам и голоду.

В других случаях движение в обратном направлении происходит по вине некомпетентного руководства. Правительство Северной Кореи ничего не сделало для своего народа с 1990 г., после того как страна лишилась поддержки Советского Союза, предпочитая вернуть людей в 1950-е гг., чем признать, что их экономическая идеология несостоятельна. В Сомали с 1991 по 2012 г. бушевала кровавая гражданская война, что не только на два десятилетия отрезало население страны от прогрессивных процессов Нового Ренессанса, но и сделало ее одним из худших на Земле мест для жизни. Сегодня в Сомали один из десяти детей умирает на первом году жизни, организованного школьного обучения практически не существует, нынешнее поколение женщин на 75 % неграмотно, а доход на душу населения (284 доллара в год) составляет одну пятую от среднего показателя этого региона (страны Центральной и Южной Африки), который сам по себе является самым низким в мире [95]. До начала гражданской войны в 2011 г. Сирия обладала одной из лучших систем здравоохранения на Ближнем Востоке. К 2014 г. 60 % больниц в стране были разрушены, число врачей уменьшилось вдвое, а нарушение программ вакцинации привело к новым вспышкам полиомиелита и кори [96].

Наконец, еще одной причиной регресса становится недобросовестное ведение бизнеса. Разграбление ренессансной Европой Северной и Южной Америки в наше время повторилось, хотя и в меньших масштабах, в регионах, также находящихся на периферии общественного внимания. Иностранный бизнес сыграл свою роль в самых громких скандалах последних десятилетий, среди которых были Бхопальская катастрофа 1984 г. (авария на химическом заводе в Бхопале, принадлежащем американской компании Union Carbide), уничтожение тропических лесов Индонезии и других стран, а также ущемление прав трудящихся и поддержка диктатуры во многих развивающихся странах. Общественные организации – Transparency International, «Гринпис», «Инициатива по обеспечению прозрачности в добывающей промышленности» (EITI) и др. – привлекают внимание общественности к деятельности этих предприятий и призывают их к ответу, но возможностей для нечестной игры остается по-прежнему много.

Проблеск величия

Поляризация благосостояния людей оказывает сильнейшее давление на нашу социальную систему. Ренессанс – бурный момент. Тот же ветер, который увлекает нас далеко вперед, поднимает огромные волны. Отчужденность и пренебрежение растут, заставляя людей уклоняться от совместной работы и даже поднимать бунт на корабле как раз тогда, когда нам нужна вся команда на палубе. Этим вопросам посвящена глава 7. Тем не менее экономическое неравенство в наиболее и наименее состоятельных слоях общества не отменяет глобального факта: мир сегодня является значительно более здоровым, богатым и образованным, чем был до начала нашего Нового Ренессанса. Это особенно верно для людей, родившихся в бедности, – сейчас у них гораздо больше шансов вырваться из нищеты и прожить долгую и здоровую жизнь, чем в любой другой момент в истории.

Положительные достижения перевешивают по двум причинам. Во-первых, масштаб. Простой факт – худшие случаи государственного коллапса и регресса относительно немногочисленны, в то время как позитивные достижения последних двух десятилетий исключительно велики. Население шести наименее развитых стран мира вместе взятых не превышает населения одной средней китайской или индийской провинции.

Некоторые возражают, что этот факт как раз ставит под сомнение недавние успехи человечества. Уберите из уравнения Китай, и вместо прогресса вы увидите картину застоя. Да, общее число людей, живущих в крайней бедности, с 1990 г. уменьшилось в два раза, но за пределами Китая оно уменьшилось лишь незначительно.

Это ошибочный аргумент. Мы должны одинаково ценить каждый новый прорыв из оков нищеты, где бы он ни происходил. Кроме того, Китай, возможно, показал пример первым, но Индия, а в последнее время и Африка находятся на пути к повторению его широкомасштабных успехов и смогут догнать его уже через несколько десятилетий. С экономической точки зрения XXI в. в Индии представляется намного более радужным, чем в Китае. Население Индии не уступает китайскому, но оно намного моложе. В ближайшие годы (до 2025 г.) Индия добавит еще 170 миллионов к собственной рабочей силе, в то время как Китаю уже приходится привлекать контрактных рабочих (несмотря на отмену политики «одного ребенка» и увеличение числа детей в семье до двух) [97]. Вслед за этим Индия повторит основные достижения Китая в области здравоохранения, благосостояния и образования.


Люди, живущие в крайней бедности, по регионам

Эпоха открытий

Снижение уровня бедности произошло главным образом в Китае

World Bank PovcalNet (2015). “Regional Aggregation Using 2011 PPP and $ 1.90/Day Poverty Line.” По материалам iresearch.worldbank.org/PovcalNet/index.htm1


Будущее Африки представляется менее определенным, но оно вполне может оказаться таким же ярким. Этот континент совсем недавно заявил о себе в контексте мировой экономики. Некоторые страны этого региона (конечно, не все) обладают богатейшими ресурсами (в Африке сосредоточено 40 % мировых запасов золота и 90 % платины), которые руками добросовестного правительства могут быть инвестированы в общественную инфраструктуру и развитие квалифицированной рабочей силы. Кроме того, добросовестное правительство понятнее: граждане лучше знают свои права и регулярно требуют у властей отчета об их действиях [98]. Африку также ждут дивиденды надвигающегося демографического взрыва. Количество трудоспособного населения стремительно вырастет с нынешних 500 миллионов человек до >1,1 миллиарда к 2040 г. [99]. Если местные власти научатся поощрять развитие соседских общин вместо трущоб, а национальным правительствам удастся интегрировать свою мелкомасштабную экономику и создать более совершенную инфраструктуру, африканцы смогут окончательно искоренить нищету уже к середине века.

Вторая причина, почему достижения в области здоровья, богатства и образования эпохи Нового Ренессанса перевешивают его недостатки, – их размах. Самый заметный разрыв в последние два десятилетия наблюдается в экономической сфере. Но хотя ВВП является подходящей точкой для начала отсчета прогресса человечества, ограничиваться им одним не стоит. Рассмотрим пример: рост ВВП Китая более 30 лет подряд на 5 % опережал рост ВВП Туниса, однако за тот же период времени продолжительность жизни женщин в Тунисе увеличилась на 14 лет (с 63 до 77), а в Китае всего на 7 лет (с 69 до 76) [100]. Тунис догнал, а затем и обогнал Китай по одному из фундаментальных медицинских показателей. Распространение множества не требующих больших затрат идей для улучшения здоровья и образования означает, что прогресс человечества сегодня в большей степени зависит от того, насколько широко страны используют эти идеи, чем от того, как быстро растут их доходы. Если мы отвлечемся от чистых доходов и обратим внимание на комбинированный статистический показатель, состоящий из доходов, продолжительности жизни и количества лет учебы, – который его создатель, ныне покойный пакистанский экономист Махбуб уль-Хак, назвал Индексом человеческого развития (ИЧР), – то увидим, что практически во всех странах, для которых имеются статистические данные, этот показатель с 1990 г. вырос, при этом бедные страны явно догоняют богатые[17]. При нынешних темпах прогресса к 2050 г. более 75 % человечества достигнет такого же уровня по индексу развития, который сегодня имеет Великобритания [101]. Самые заметные рывки вперед происходят в странах, о которых мы почти не говорим, – таких как Руанда, с 2008 г. поднявшаяся вверх по ИЧР быстрее – на 17 позиций, – чем любая другая страна [102].


Сейчас мы видим потенциал человечества более ясно, потому что мы оказались к нему намного ближе. В эпоху предыдущего Ренессанса замеченный людьми проблеск собственного величия вызывал к жизни самый известный феномен той эпохи: гений.

Часть II

Расцвет гения

Как нынешнее время порождает гений и увеличивает масштаб коллективных достижений

4

Коперниканские революции

Почему сейчас происходят большие перемены

Переворот в сознании

В 1504 г. Николай Коперник (1473–1543) – днем обычный каноник, ночью увлеченный астроном – решил, что обязательно должен увидеть своими глазами необыкновенное явление: происходящее раз в двадцать лет Великое сближение Юпитера и Сатурна [1]. Наблюдение за звездами было для Коперника сродни богослужению: разве есть лучший способ славить Бога, чем изучать небеса? Поэтому в те семь лет, что он прожил в Италии, изучая медицину и церковное право, он пользовался любой возможностью удовлетворить свою личную страсть: брал дополнительные занятия по геометрии, помогал профессорам астрономии вести ночные наблюдения и изучал теории и звездные карты других астрономов, древних (Птолемей) и современных (Пурбах, Региомонтан), как только они выходили из печати. Теперь, через год после возвращения в родную Польшу, он вооружился астролябией и надежным альманахом (изданием Альфонсинских таблиц 1492 г.) и приготовился делать заметки о движении планет друг к другу.

Однако то, что Коперник увидел, во многом озадачило его. Прежде всего выяснилось, что альманах не так уж надежен. В Альфонсинских таблицах, составленных в XIII в., было рассчитано положение Солнца, Луны и известных планет начиная с 1252 г. и далее. Они были главным трудом средневековых астрономов. Но они были неточными. Сближение 1504 г. действительно произошло, как было предсказано, но с опозданием на одну-две недели, а положение планет в небе отклонялось на один-два градуса.

Второй вопрос, которым задался Коперник, был философского свойства. Таблицы составили на основе Птолемеевой модели небес, которую Коперник считал слишком запутанной и неэлегантной, неспособной отразить замысел Бога. Птолемей считал, что Земля неподвижно стоит в центре Вселенной, – этот очевидный факт ежедневно подтверждался восходом и заходом солнца. Но планеты двигались менее предсказуемо. Если смотреть с Земли, они исполняли какой-то странный танец, сновали из стороны в сторону, через неравные промежутки времени становились то ярче, то темнее. Чтобы объяснить все это, Птолемей разработал сложную систему циклов, эпициклов и эквантов – странные и сложные правила движения Солнца, Луны и планет, которые оставались в силе на протяжении 1400 лет просто потому, что они работали. Они более или менее надежно предсказывали, когда и где будут находиться все небесные тела – с погрешностью в одну-две недели времени и один-два градуса расстояния.

Эти вопросы не давали Копернику покоя следующие десять лет, пока в 1510 г. у него не случилось озарение [2]. Это озарение было настолько ясным в своей простоте, что казалось ниспосланным свыше, и вместе с тем настолько ошеломляющим, что он ждал более тридцати лет, прежде чем опубликовать свои размышления, – и тогда сделал это лишь благодаря настойчивости своего ученика, который был потрясен теорией Коперника, изложенной им небольшой группе ученых друзей около 1514 г. Предположим, что центром Вселенной является не Земля, а Солнце; предположим, что день сменяет ночь не в результате движения Солнца, а в результате вращения Земли вокруг своей оси; представим, что Земля обращается вокруг Солнца, как любая другая планета.

Этот набор заявлений казался абсурдным. Если Земля действительно вращается с запада на восток вокруг собственной оси, тем самым обеспечивая смену дня и ночи, то скорость этого вращения должна быть огромной. Почему тогда все, что находится на поверхности земли – здания, деревья, люди, – стоит прямо? Почему инерция этого движения не разбрасывает птиц и облака по всему небу? Этого Коперник не знал. Более того, если Земля вращается вокруг Солнца, почему звезды остаются неизменными? Когда мы закрываем один глаз, а затем другой, находящиеся перед нами предметы двигаются из стороны в сторону (этот эффект называется параллакс), – и если мы действительно перемещаемся вокруг Солнца с одной стороны на другую, то и звездное поле должно каждый год двигаться из стороны в сторону. Убежденный в истинности своей теории, Коперник мог только высказать догадку, что звезды действительно двигаются, но они находятся так далеко от нас – в тысячи раз дальше, чем осмеливался предположить Птолемей, – что наши глаза и оптические инструменты просто не улавливают разницы. Появившиеся в начале XIX в. новые телескопы доказали, что поляк был прав, но в XVI в. современники насмехались над его не поддающейся проверке теорией. Тихо Браге посвятил свою жизнь составлению как можно более подробного описания небес, чтобы доказать, что Коперник ошибается. Как ни странно, именно эти данные помогли утвердить превосходство коперниканской модели над Птолемеевой и ускорили ее принятие.

Коперник поставил под сомнение представления, на которые опиралась вся астрономия прошлого, и перевернул их с ног на голову. В XX в. философ Томас Кун предложил называть такого рода открытия сменой парадигмы, или переворотом в сознании. Рабочие гипотезы пускают в нашем мышлении глубокие корни, и добиться такого переворота чрезвычайно трудно. (Книга Коперника «О вращении небесных сфер» (De revolutionibus orbium coelestium), опубликованная в 1543 г., более двухсот лет находилась под церковным запретом.) Но он исключительно важен, поскольку у каждой парадигмы сознания есть свои пределы, и рано или поздно с этими пределами необходимо встретиться лицом к лицу. Иначе прогресс остановится. Гелиоцентрическая теория Коперника имела свои недостатки – на самом деле Солнце является центром Вселенной не больше, чем Земля, – но она вывела астрономию за рамки, установленные Птолемеем, и обозначила множество новых направлений продуктивного исследования. Как доказать, что планеты вращаются вокруг Солнца, а не вокруг Земли? В 1610 г. этот вопрос побудил Галилео Галилея (1564–1642) направить новое голландское изобретение (телескоп) вверх и собрать данные о фазах Венеры и спутниках Юпитера. Как точнее всего описать орбиту планеты? В виде эллипса, обнаружил Иоганн Кеплер (1571–1630). Он вывел три закона движения планет, благодаря которым погрешности в новых альманахах сократились до двух десятых градуса[18]. И почему, если Земля действительно вертится и перемещается в пространстве, никто этого не чувствует? Инерция, ответил сэр Исаак Ньютон (1642–1727), – и этот ответ стал первым из найденных им трех законов динамики. Открытие Коперника вышло далеко за пределы эпохи Ренессанса и далеко за пределы астрономии. Он заложил новый фундамент, на котором была построена вся современная физика.


Когда гений становится обычным явлением

Мы называем подобные редкие достижения гениальными, но в эпоху Возрождения они стали на удивление обычным явлением. В философии, науке, технике и искусстве произошел радикальный отрыв от принципов, господствовавших ранее. Совокупность переворотов в сознании в масштабах всего общества составила процесс, который современные историки обозначают как переход от Средневековья к раннему Новому времени. В основе этих перемен лежал философский сдвиг, о котором шла речь в начале главы 3, когда от признания своего данного Богом места в Великой цепи бытия человечество перешло к попыткам подняться выше этого места. Радикальное переосмысление смысла жизни сопровождалось постепенным изменением представлений об истине, которую теперь постигали не в откровениях, а в наблюдениях. Новое мышление изменило наши представления о земной поверхности (см. главу 1), а через Коперника изменило и наши представления о небе.

В медицине это новое мышление начало менять модель человеческого тела от духовной к анатомической. Препарирование человеческого тела стало обычной практикой в медицинских школах, были изданы точные схемы скелета, мышц, артерий и вен, внутренних органов, нервной системы и головного мозга. Сердце, как обнаружил Мигель Сервет (1509–1553), было не вместилищем души, а насосом. Химия перешла от алхимии к научным экспериментам. Попытки превратить свинец в золото по старинным рецептам постепенно сменились накоплением данных о том, какие реакции при этом действительно происходят, как более эффективно получать спирты, кислоты и другие вещества и какое воздействие эти зелья оказывают на больных людей.

Появились новые направления исследования. Сегодня за философией Никколо Макиавелли, который в своем знаменитом трактате «Государь» (Il Principe) преподносит насилие и обман как положительные качества лидера, закрепилось название «макиавеллизм», но пятьсот лет назад для читателей стало настоящим потрясением то, что Макиавелли, кроме обычных восхвалений достоинств правителей, запечатлел и наблюдения за их реальным поведением. С тех пор ученые-политологи следуют по его стопам.

Рука об руку с новыми представлениями о мире шли новые инструменты и технологии. Морские суда стали больше, прочнее, получили более разнообразную парусную и рулевую оснастку – и были пригодны для океанских плаваний. Более точные компасы и другие навигационные устройства позволили штурманам прокладывать курс в те места, куда раньше они не решались заплывать. В сельском хозяйстве начали внедрять новые методы (откорм скота в стойле и севооборот), которые значительно увеличили объем сельскохозяйственного производства в течение следующих трех столетий. Горный промысел, исчерпав мелкие месторождения Европы, устремился в новые глубины и встретил, а затем и преодолел новые технические проблемы: в шахтах были налажены отвод воды и вентиляция, вертикальный подъем руды и предотвращение затоплений и взрывов. Инженеры-металлурги соорудили первые доменные печи (производившие больше железа более высокого качества) и разработали новые сплавы. Инженеры-гидравлики переняли увлечение древних римлян гидротехническими сооружениями и усовершенствовали их – так появились дамбы, насосы и трубопроводы, облегчавшие работу в шахтах, на мельницах и в портах. Архитекторы разработали новые грузоподъемные механизмы, позволявшие поднимать гигантские купола таких размеров, каких не видели со времен Цезаря. Появились ранние виды скрипок, гитар и других инструментов, что привело к созданию новых видов музыки.

Самые заметные перемены, которые сразу приходят на ум при упоминании этой эпохи, произошли в изобразительном искусстве. Средневековое искусство отличалось элегантной простотой и таинственностью, но вместе с тем оно было плоским и шаблонным. Его главной целью было доходчиво рассказать Священную историю. Плагиат был обычной практикой – привнесение новых мотивов могло быть расценено как богохульство. Но постепенно на смену старым представлениям пришли новые: теперь задачей художника стало запечатлеть фрагмент мира так, как он его видит, и это привело к появлению все более реалистичных, оригинальных и светских по духу работ.


Ренессанс преобразил изобразительное искусство

Эпоха открытий

а) Мадонна с Младенцем. XIV в. (?)

Икона Божьей Матери Неустанной Помощи. Происхождение неизвестно, вероятно, Крит, около XIV в.

Церковь Сант-Альфонсо ди Лигуори, Рим, Италия


Эпоха открытий

б) Мадонна с Младенцем. XV в.

Сандро Боттичелли (около 1480). Мадонна с книгой.

Из собрания музея Польди Пеццоли, Милан, Италия


Изменения начались с работы таких художников, как первооткрыватель линейной перспективы Филиппо Брунеллески (чтобы передать на холсте глубину пространства, он рисовал отдаленные предметы меньшего размера) и Ян ван Эйк (около 1390–1441), который, вместо того чтобы писать идеализированные обнаженные фигуры, ставил перед собой обычных обнаженных натурщиков и запечатлевал индивидуальные особенности внешности каждого человека. На вершине Ренессанса Леонардо да Винчи и Микеланджело создали новый идеал в искусстве. Сегодня их работы восхищают нас необыкновенной красотой, но в то время они поражали зрителей еще и своей необычностью. До Леонардо никто и никогда не писал таких реалистичных портретов, как «Мона Лиза». Секрет художника, родившийся из долгих лет изучения свойств человеческого зрения, заключается в том, что он оставил уголки рта и контуры тела женщины слегка размытыми, предоставляя дорисовывать подробности мозгу зрителя, а не кисти художника. Тщательное изучение человеческой анатомии помогло Микеланджело создавать из мрамора необыкновенные скульптуры, одновременно динамичные и грациозные, в которых каждый мускул и каждая связка занимают отведенное им природой положение.


Леонардо и Микеланджело сочетали личное вдохновение с внимательным изучением реального мира

Эпоха открытий

а) Леонардо да Винчи (1503–1517?). Мона Лиза.

Из собрания Лувра, Париж, Франция


Эпоха открытий

б) Микеланджело Буонарроти (1513–1516). Умирающий раб (фрагмент).

Из собрания Лувра, Париж, Франция


Но все эти революционные изменения не были мгновенными. Коперник упорно настаивал на том, что орбиты планет должны быть круглыми, поскольку замысел Бога выражается через круг [3]; хроника ренессансной медицины заставила бы вздрогнуть современных читателей; Леонардо, как и многие его современники, увлекался алхимией. Научная революция едва зародилась, и ей предстояло развиваться еще не одну сотню лет. Однако новые парадигмы принесли достаточно ранних успехов, благодаря которым этот процесс пошел быстрее. В 1450 г. Западная Европа существенно отставала от Китая и арабского мира во многих областях прогресса – в науке, практических исследованиях, навигации, изготовлении железа и стали, вооружении, сельском хозяйстве, текстильном производстве и исчислении времени. Но в 1550 г., как показал гарвардский историк Найал Фергюсон в опубликованной в 2011 г. книге «Цивилизации: Запад и другие» (Civilizations: The West and the Rest), Европа обогнала их по всем этим параметрам и сосредоточила в своих руках больше организационных и энергетических ресурсов, чем любая другая цивилизация на Земле [4].

Пожалуй, это был самый бурный и стремительный расцвет гения в человеческой истории.

Новые перемены

Наши собственные масштабные коперниканские перевороты уже начались. Заметнее всего перемены, о которых шла речь в части I, – превращение политических и экономических систем из закрытых в открытые и переход с аналогового формата на цифровой, – но и в более узких областях сейчас происходит тот же процесс. В дипломатии абсолютное право государства распоряжаться собственными внутренними делами – краеугольный камень международных отношений по крайней мере с 1555 г.[19] – оспаривается гуманистической концепцией ответственности за защиту граждан других стран, международным уголовным судом, обладающим полномочиями привлекать к ответственности за преступления против человечности, и растущим осознанием того факта, что ни одно государство не может добиться внутреннего процветания без поддержки международного сообщества (здесь наглядным примером служит Северная Корея). В бизнесе переосмыслено само понятие «фирмы». Старая идея о том, что предприниматели создают фирмы, поскольку это более экономично, чем получать все нужные им товары и услуги на рынке, в настоящее время опровергается цифровыми платформами, которые снижают операционные издержки и дают возможность получить новый ассортимент мелких услуг. Согласно новым представлениям, основная ценность фирмы заключается в присущем ей уникальном наборе ценностных предложений и практик. Точно так же меняется характер трудовой деятельности – от полной занятости к временным контрактам. Начиная с 1995 г. более половины всех рабочих мест, созданных в странах с развитой экономикой (состоящих в ОЭСР, Организации экономического сотрудничества и развития), относятся к сфере частичной занятости, индивидуального предпринимательства или фриланса [5]. Цифровые независимые платформы, такие как Upwork, Task Rabbit и Thumbtack, стремительно завоевывают популярность от Миннеаполиса до Мумбаи [6]. В искусстве исчезает грань между художником и аудиторией, участие публики в акте создания становится обычным явлением.

Но самое наглядное подтверждение дает наука. Гений предыдущего Ренессанса очевиден для нас сейчас, пятьсот лет спустя, потому что мы можем сопоставить изменения, которые пережила Европа, с отсутствием изменений в других частях света (с учетом разницы местных условий). Сегодня такой возможности у нас конечно нет. Мы не можем заглянуть на пятьсот лет вперед в наше собственное будущее и не можем выбрать подходящие примеры для сравнения: соединяющие и развивающие силы нашего времени имеют глобальный характер. Поэтому трудно заранее судить, например, о роли социальных сетей – что это, просто более удобный способ поддерживать контакт или фундаментальный сдвиг от физической к виртуальной форме общества.

В науке, в особенности в естественных науках, происходят еще более заметные скачки. Коперник обнаружил, что переписать основные принципы, лежащие в основе науки, очень трудно. Теория и практика подтверждаются сведениями, которые собирали десятилетиями, иногда даже веками, и, чтобы изменить их, опровергнуть этот корпус подтверждений, необходимо предложить объективно более подходящий вариант. С другой стороны, когда этот спор выигран, наука совершает более быстрый и решительный переход к новой парадигме, чем любая другая область. (Никто не хочет продолжать и дальше двигаться по пути, ошибочность которого уже доказана.) Это означает, что мы можем обнаружить большие перемены даже в краткосрочной перспективе и рассчитывать на то, что они сохранят свое значение.

Естественные науки представляют собой обширную сложную экосистему человеческой умственной деятельности, состоящую из множества областей и подобластей, но, если говорить упрощенно, существуют две основные отрасли: науки о живой природе (изучение живых существ) и естественные науки (изучение неживой природы). Первая ветвь тянется от физики (что такое вещество) к химии (как вещество ведет себя) и биологии (какие живые формы принимает вещество) и заканчивается медициной – как мы применяем науки о живой природе, чтобы продлить жизнь. Вторая отрасль также берет начало в физике и химии, но исследует материалы (неживые формы вещества) и заканчивается инженерным делом – как мы применяем изученные свойства материалов, чтобы создавать полезные вещи.

В обеих отраслях сейчас происходят по-настоящему масштабные изменения, и, если задуматься, они не менее прекрасны, чем любой прорыв в искусстве. Взятые вместе, они являются лучшим доказательством того, что наша жизнь готова преобразиться. Одна отрасль определяет качество и продолжительность жизни каждого из нас. Другая создает материалы, которыми мы наполняем жизнь.


Наука о жизни: от медицинских процедур до генетических преобразований

История медицины насчитывает пять тысяч лет, и почти все это время человеческое тело принимали как данность. Джеймс Уотсон, в 1953 г. совместно с Фрэнсисом Криком открывший ДНК, сказал, что мы были «крохотными пешками в игре, сценарий которой писали не мы». Роль медицины в этой драме ограничивалась лечением: объяснить, как работает человеческое тело и почему иногда оно отказывается это делать, постараться предотвратить или, если это не удалось, вылечить болезнь. Медицинские теории за последние несколько тысячелетий не раз менялись, начиная от воли богов и ду́хов, а затем «гуморов» до микробов и нездорового образа жизни, но задача медицины оставалась неизменной, и заключалась в том, чтобы бороться с этими врагами.

Лечение, сводившееся в общих чертах к лекарственным средствам плюс хирургия плюс просвещение, до сих пор очень нам помогало. Медики разработали вакцины, оградившие нас от самых смертоносных убийц в истории, в том числе от оспы (1790-е гг.) и полиомиелита (1950-е гг.). В 1921 г. исследователи выделили инсулин, естественный белок поджелудочной железы, помогающий контролировать уровень сахара в крови, и обеспечили им в массовом порядке четверть миллиарда диабетиков, в организме которых собственные запасы инсулина не выполняли нужную задачу. Они открыли пенициллин (1928), а вслед за этим целый класс антибиотиков и противомикробных препаратов, защищающих нас от инфекций. Постепенно разбираясь в химии человеческого организма, ученые разрабатывали новые препараты, позволявшие воздействовать на нее согласно нашим целям. Они изобрели противозачаточные таблетки для регулирования рождаемости, антидепрессанты (прозак), чтобы стабилизировать наше душевное состояние, статины (липитор), помогающие снизить уровень холестерина, и виагру, чтобы продлевать эрекцию.

Список медицинских достижений в области хирургии впечатляет не меньше. Например, возьмите трансплантаты. Трансплантация занимает законное место среди высших триумфов медицины, поскольку она требует глубокого понимания работы внутренних органов, а также химических процессов, происходящих в организме, – иначе он будет отторгать трансплантированные клетки. В 1950-е гг. хирурги впервые осуществили пересадку почек, в 1960-е гг. – поджелудочной железы, печени и сердца. Десять лет спустя удалось трансплантировать легкие. Перенесемся в наше время – и сегодня медицина уже способна заменить ваши яичники, пенис, ноги, руки и кисти рук, а начиная с 2010 г. все ваше лицо донорскими органами, пожертвованными кем-то другим. На 2017 г. запланирована первая операция по пересадке человеческой головы. Мы до такой степени подчинили себе работу человеческого тела, что можем даже отключать и снова включать его. В 1970-е гг. холодное, безжизненное и бездыханное тело было бы немедленно объявлено мертвым. Сегодня хирурги могут поддерживать нас в таком состоянии в течение получаса, а потом разбудить, словно от глубокого сна (через полчаса значительно возрастает вероятность повреждения клеток головного мозга) [7].

Успехи просвещения и профилактики, хотя они и не становятся темой броских газетных заголовков, не менее значительны. Антитабачная пропаганда сделала для сокращения распространения рака легких больше, чем все лекарства и операции вместе взятые [8]. Внушив людям мысль о необходимости мыть руки перед едой, мы одержали одну из самых больших побед в борьбе с распространением инфекции, от ресторанов Токио до фавел Рио-де-Жанейро.


Пределы

Но, несмотря на все успехи, возможности лечения не беспредельны. И главный предел – старение. Даже при самом заботливом уходе тело стареет, разрушается и умирает. Второй предел – генетика. Несмотря на все усилия, наша собственная природа может обернуться против нас, помешать функциональности организма или сделать нас более уязвимыми. Третий предел – хронические заболевания, которые успешно сопротивляются лечению главным образом потому, что причина их возникновения часто обусловлена сочетанием первых двух факторов. Например рак. Мы знаем, что, если в семье были случаи заболевания раком, вероятность того, что мы тоже заболеем, возрастает. Это генетика. Но, кроме того, многое зависит от возраста. ДНК, с которой мы рождаемся, несколько отличается от ДНК, с которой мы умираем. В течение жизни клетки делятся, отмирают и восстанавливаются снова и снова, при этом в них накапливаются небольшие мутации. Чем старше мы становимся, тем больше мутаций накапливают наши клетки. Если среди них окажутся неправильные, клетки могут начать бесконтрольно размножаться – это и есть рак. Другие хронические болезни – диабет, болезнь Альцгеймера, рассеянный склероз – также упорно сопротивляются современной медицине.

Чтобы преодолеть эти ограничения, мы должны выйти за пределы существующей модели лечения. Именно этим сейчас занимается медицинская наука. Ученые уже не стараются максимально повысить качество жизни в отведенных природой границах, они научились разбираться в человеке достаточно глубоко (по их мнению) и теперь ставят перед собой намного более смелые цели: преобразовать организм человека таким образом, чтобы этих ограничений оставалось все меньше и меньше.


Книга жизни

Изучение генетики началось в 1860-е гг. с монаха-августинца Грегора Иоганна Менделя, который терпеливо выращивал 30 тысяч побегов гороха и в результате наблюдений пришел к выводу, что природу «детского» растения определяет сочетание доминантных и рецессивных признаков, унаследованных от обоих «родителей». Около 1900 г. ученые выяснили, что эти унаследованные, или наследственные, признаки переносятся хромосомами внутри ядра клетки. А в 1950-х гг. они обнаружили внутри хромосом главное хранилище генетической наследственности: умную молекулу в виде двойной спирали, получившую название ДНК.

ДНК – язык природы, с помощью которого осуществляется хранение и копирование генетической информации. Это цифровой код. Но вместо нулей и единиц каждая цепочка состоит из длинной последовательности простых молекул A, C, G и Т (аденин, цитозин, гуанин и тимин), присутствующих во всех клетках живых организмов. Эти четыре молекулы имеют особое свойство: А может соединяться только с Т, а С – с G. Если фрагмент одной цепочки состоит из C-G-A, противоположный фрагмент другой цепочки в этом месте должен состоять из G-С-Т.

Один этот факт обеспечивает генетические данные всех форм жизни на Земле. Эту простую химию (А = Т, С = G) природа использует, чтобы точно копировать генетическую информацию каждый раз, когда клетка делится.

Но ДНК – не просто резервуар, где генетическая информация хранится до того момента, когда придет время произвести потомство. Другие молекулы, РНК, постоянно проходят сквозь это хранилище, записывая короткий фрагмент кода ДНК (ген), а затем перенося эту информацию в один из заводских цехов клетки: рибосомы. Рибосома с полученным фрагментом в руке, сверяясь с тем же цифровым декодером, собирает соответствующую цепочку аминокислот. После сборки эти двумерные цепочки складываются в сложные трехмерные формы. Мы называем эти разнообразные 3D-формы белками. Белки, отвечающие за строительство мышц и костей, представляют собой небольшую и хорошо изученную группу. Белки участвуют во всем: от переработки пищи в топливо до производства и ликвидации химических веществ, борьбы с инфекциями и транспортировки кислорода. Исследователи считают, что в человеческом организме имеется около 100 тысяч видов различных белков – все вместе они составляют примерно 75 % сухой массы тела. ДНК – язык, на котором кодируется каждая из этих разновидностей.

ДНК отвечает на вопрос о том, что делает меня мной, а вас – вами, а также объясняет, как работает человеческое тело начиная с молекулярного уровня и далее. С момента открытия этого генетического кода мы прикладывали все усилия, чтобы разобраться в нем. К сожалению, он а) слишком длинный и б) написан на языке, которого мы не знаем. Представьте обычный лист бумаги, заполненный от края до края сверху донизу строчками, набранными двенадцатым кеглем, сплошь из букв А, C, G и T, – что-то вроде:

gtgaacaagaaatgatgctttgtctggtatgcatggtaaataatgccccttgctctctgcttcatgatcacatgtgatacttctaacatagatagcacatgtaaatc

Геном человека заполнил бы 1 миллион таких листов (площадь примерно десяти футбольных полей). При этом код не прерывается никакими пробелами или знаками препинания, которые помогли бы нам уловить его смысл.

Поскольку мы не можем прочитать ДНК непосредственно как текст, единственным способом отыскать смысл в этом коде является сравнение. Ученые сравнивают ДНК человека, который страдает, например, муковисцидозом, с ДНК здорового человека и выявляют различия. Затем они изучают ДНК других людей, страдающих муковисцидозом, чтобы определить, какими из этих отличий обладают все больные. В 1989 г. муковисцидоз стал первым генетическим расстройством, первопричину которого, лежащую в ДНК, удалось выявить таким способом. (Приведенный выше фрагмент кода – всего лишь 230 из >230 тысяч символов, с помощью которых болезнь записана в генах.) Сравнение оказалось мощным инструментом для превращения ДНК в осмысленный текст. Но это был медленный процесс. К 1990 г. все мировые «библиотеки» расшифрованных фрагментов ДНК вместе взятые составляли менее 1 % общего объема генетического кода [9]. Многие биологи считали, что изоляция всех генов – задача, лежащая за пределами человеческих возможностей.


Гений

Сегодня никто уже так не считает. Область и перспективы исследования выглядят совершенно по-другому.

В 1990 г. генетики всего мира были разбросаны по сотне лабораторий, в основном расположенных внутри университетов. По большей части они проводили исследования независимо друг от друга, а совместные работы не выходили за пределы одного государства. Сегодня они работают в тысячах общественных и частных лабораторий и научно-испытательских учреждений, а количество и сложность их научных связей, преодолевающих как экономические, так и национальные границы, превратили генетику в по-настоящему транснациональный научно-исследовательский проект. Проект «Геном человека», запущенный в начале 1990-х гг. с целью составить полную схему генома, проходил под руководством американских ученых. Следующая ступень, проект «Протеом человека», был запущен в 2010 г., его цель – описать все виды человеческих белков; в этом глобальном начинании участвуют 25 исследовательских групп из 19 разных стран.

Это более многочисленное и плотное научное сообщество снова изменилось после возникновения новых, более эффективных инструментов и методов работы. Одним из самых больших затруднений сравнительного метода было секвенирование ДНК. После того как была проделана трудная работа по обнаружению гена, отвечающего за муковисцидоз (в нашей седьмой хромосоме), началось настоящее испытание: нужно было выписать фактическую последовательность A, C, G и T в этом фрагменте. Это была трудоемкая и технически непростая лабораторная работа, в процессе которой ученые проводили долгие часы над пробирками, центрифугами и электронными микроскопами. Исследователь, не имеющий больше никаких заданий, мог бы секвенировать 100 тысяч символов в год. В таком случае, для того чтобы секвенировать геном человека целиком, потребовалось бы 30–50 тысяч человеко-лет. Поэтому никто и не пытался это сделать. Понимая, что у них никогда не будет достаточно времени или денег, чтобы выполнить эту работу, ученые ничего не предпринимали, пока у них не появлялось по-настоящему существенное предположение, почему именно этот фрагмент может быть важен. Секвенирование должно было неукоснительно следовать за конкретной гипотезой. В противном случае оно превращалось в черную дыру, которая поглощала карьеру исследователя, не давая ничего взамен.

Но начиная с 1980-х гг. ученые, решившие преодолеть это затруднение, ввели ряд технических новшеств. Машины для секвенирования помогли автоматизировать многие задачи процесса декодирования, которыми ранее занимались лаборанты. Были изобретены машины для копирования ДНК, которые могли взять один интересующий ученых фрагмент ДНК и за одну ночь сделать миллионы копий, что, в свою очередь, ознаменовало появление более быстрых секвенсоров, предназначенных для применения грубой силы к неисчерпаемому источнику материала. Математики разработали новые статистические модели, чтобы разобраться, как соединить любое количество фрагментов в правильном порядке, возник «метод дробовика» (суть этой техники в делении всего генома на десятки тысяч очень коротких фрагментов), позволяющий воспользоваться новой возможностью – «сначала секвенирование, потом упорядочивание». И наконец, программисты разработали более совершенное аппаратное и программное обеспечение, позволяющее отделять, сравнивать и сохранять стремительно возрастающие объемы данных, полученных с помощью этих новых методов.

Резкое возрастание умственных и вычислительных мощностей перевернуло модель исследования в генетике с ног на голову. Старая модель говорила: мы не можем вскипятить океан, поэтому давайте предположим, какая чашка в нем важнее, и вскипятим ее. Новая модель говорит: мы можем вскипятить океан, так давайте сделаем это и посмотрим, что мы найдем. В конечном счете, чтобы полностью секвенировать геном человека, понадобилось не 30 тысяч, а всего 15 лет. Сроки и стоимость секвенирования по-прежнему падают даже быстрее, чем предсказывает закон Мура. Чтобы секвенировать первый геном, понадобилось 15 лет и 3 миллиарда долларов; в 2015 г., чтобы секвенировать другой геном, потребовалось всего 6 часов и 1000 долларов [10].


Стоимость секвенирования 1 генома, 2001–2005

Эпоха открытий

Стоимость секвенирования генома снижается быстрее, чем предсказывает закон Мура.

Kris Wetterstrand (2015). “DNA Sequencing Costs: Data from the NHGRI Genome Sequencing Program (GSP).” National Human Genome Research Institute. По материалам www.genome.gov/sequencingcosts


К 2003 г. генетики покрыли все 10 футбольных полей чертежами человеческого устройства. Хотя это важное событие приобрело огромную известность, его научное значение было ограничено, так как в распоряжении ученых на тот момент не было других образцов генома человека, с которыми можно было бы сравнить полученный результат. Сегодня они появились. К 2015 г. удалось секвенировать более 250 тысяч полных геномов и миллионы частичных [11]. С помощью этих данных, а также вычислительной мощности компьютеров, позволяющих их анализировать, исследователи выявили в общей сложности примерно 20 тысяч генов, отвечающих за кодирование белков, и в большинстве случаев уже установили, какие белки они печатают [12].


Но это не книга

Теперь, когда ученые, изучающие жизнь, имеют дело с целыми геномами, они начали открывать много такого, чего прежде даже не могли заподозрить. ДНК играет в биологии гораздо более сложную роль, чем считалось всего десять лет назад. Наука выяснила, что лишь 1–2 % нашей общей ДНК на самом деле отвечает за кодирование разнообразных белков. Первым делом исследователи подумали, что остальные 98 % просто мусор – эволюционные отбросы, пока еще не отсеянные в процессе естественного отбора. Сейчас они уже не так в этом уверены. По крайней мере, стало известно, что часть «мусора» заключает в себе различные инструкции, касающиеся не штамповки, а более тонкой организации уже полученных белков. Человек устроен гораздо сложнее мушки-дрозофилы, и не только потому, что наши ДНК печатают больше белков, но главным образом еще и потому, что человеческий организм способен гораздо более утонченно манипулировать этими белками. Исследования также обнаружили, что некоторые наследственные черты вообще не кодируются в нашей ДНК. Эта новая научная отрасль называется эпигенетикой, и она так молода, что ученые выработали ее определение только в 2008 г.

А главное, наука теперь просит нас вообще отказаться от мысли, что ДНК представляет собой чертеж или схему. Скорее это склад полезных идей, которые природа накапливала с тех пор, как зародилась жизнь. Да, из ДНК возникают белки, из которых, в свою очередь, возникают клетки, которые, в свою очередь, создают ткани, которые, в свою очередь, создают органы, а вслед за тем целый организм. Но ДНК определяет организм не более, чем склад запчастей определяет, какой автомобиль будет из них собран. Этот автомобиль собирается на территории склада механизмами, которые переносят нужные детали от стеллажей к сборочной линии; его собирают рабочие, обслуживающие конвейер, и роботы, которые запрашивают определенные детали и сваривают их, дизайнеры и инженеры, которые решают, какими качествами должен обладать автомобиль, руководители, принявшие решение выпустить легковой автомобиль, а не грузовик. Каждый уровень системы может общаться с любым другим уровнем, каждый может вызвать новую цепь событий, формирующую любую другую цепь. То же самое происходит в жизни. Примерно с 2000 г. системная биология с помощью этого нового понимания начала разрушать редукционистские детерминированные представления о ДНК [13].


Природа преобразованная

Обратной дороги нет. Последние достижения в области биологии навсегда изменили отношения человека с природой. Самая непосредственная власть, которую они дают, – это познание человеком самого себя. Наши сильные и слабые стороны и склонности, как миролюбивые, так и патологические, имеют под собой физическое основание. То же касается нашего будущего. Вскоре медицина получит возможность моделировать взросление организма с помощью компьютерных программ. Но мы не только увидим проекцию своей внешности в 25 лет: наш виртуальный двойник сможет послужить безопасной лабораторией, в которой будут проверять, как наше тело реагирует на новые лекарства, операции и перемены в образе жизни. Создание новых лекарств шагнет вперед, поскольку возникшая возможность быстро и дешево воспроизвести массовые клинические испытания спишет сегодняшние методы как устаревшие.

Глубже познав себя, мы сделаем лечение персонализированным. Благодаря недавнему приросту населения и снижению детской смертности люди как вид сегодня обладают гораздо большим генетическим разнообразием, чем когда-либо. В последнее время у естественного отбора не было ни времени, ни возможности срезать новые мутации с генетического дерева человека. Это имеет значение для здоровья: получается, что самые старые части генома человека – те строки нашей ДНК, которые прошли испытание боем в течение миллиардов лет эволюции и совпадают у большинства из нас, – также являются самыми стойкими и непробиваемыми. Генетически слабые места в нашей броне относятся по большей части к так называемым редким вариациям – более поздним строкам кода, которыми обладают менее 1 % людей. Другими словами, все человеческие существа одинаковые, но разные. Массовая медицина обходит молчанием последний факт – персонализированная медицина будет уделять ему должное внимание. В 2015 г. Управление по санитарному надзору за качеством пищевых продуктов и медикаментов США (FDA) одобрило первые распечатанные на 3D-принтере лекарства, которые можно изготовлять на заказ в идеальном соответствии с требуемой дозировкой и возможностями приема каждого пациента. А родители уже могут приобрести генетические тесты, чтобы проверить своих детей на сотни известных мутаций и расстройств. Недалек день, когда машина для секвенирования будет стоять в каждой клинике общей практики.

Мы взломаем ДНК. Мы откроем это природное хранилище, чтобы исправить ошибки или теоретически добавить новые функции. Сама природа все время так поступает – с помощью вирусов. Вирус – это просто фрагмент ДНК, снабженный рядом защитных слоев, который входит в ядро клетки и переписывает ДНК хозяина, чтобы изменить функции клетки. Наука называет эту новую область генной терапией, и ученые пока делают в ней заметные успехи. Они разработали вирусы, которые могут перепрограммировать наши собственные клетки на создание белка, отсутствие которого вызывает муковисцидоз, преодолеть наследственное заболевание крови, побудив кровяные клетки производить достаточное количество гемоглобина, а также направлять собственные антитела нашего организма на поиск и уничтожение раковых клеток или ВИЧ, – и это лишь немногие из последних лабораторных достижений. В конце 2013 г. на рынок был выпущен первый в мире одобренный препарат генной терапии Glybera. Это вирус, который при введении в кровь пациента, страдающего панкреатитом, инфицирует клетки и перепрограммирует их, заставляя производить недостающий белок, необходимый для расщепления жирных кислот. Генная терапия по-прежнему сталкивается со многими ограничениями – главное среди них то, что она не может переписать ДНК всего нашего организма, только ДНК клеток, которые инфицирует, – но это доказывает, что исправление ошибок ДНК является в принципе выполнимой задачей.

Генная терапия – скромный пример использования новых генетических возможностей человечества. Мы уже способны на гораздо более странные вещи. Ученые скрещивали в чашке Петри виды, которые никогда не сочетались в природе, получая здоровые особи бифало (гибрид коровы и бизона), лигра (гибрид льва и тигра), зебролошади и овцекозы. Они внедряли кошкам отвечающие за флуоресценцию гены медузы, в результате чего кошки начинали светиться в темноте. Они внедряли в один из видов дрожжей гены полыни, и, вместо того чтобы выделять спирт, дрожжи выделяли редкое лекарство против малярии. Мы еще не знаем в полной мере, насколько совместимы ДНК-коды разных видов, но ученые проводят эксперименты в лабораториях по всей планете, чтобы это выяснить. В конце концов, каждое растение, животное или бактерия, с которыми мы соседствуем на Земле, могут внести свой вклад – блоки готового кода, которые генетические программисты смогут объединить для создания химерных организмов, удовлетворяющих человеческие потребности и фантазии.

Следующей важной вехой в этой области, которая называется синтетической биологией, будет разработка с нуля проекта совершенно нового организма. Зачем ограничивать себя существующими в природе базами кодов? Наберите в поисковике «синтез ДНК на заказ», и вы найдете десятки частных лабораторий, предлагающих синтезировать практически любую последовательность ДНК по цене около 20 центов за один символ[20]. После этого в течение двух-четырех недель вам пришлют пробирку с результатом. Обладая такой силой, мы могли бы в один прекрасный день ускорить эволюцию: взять ДНК лошади, воспроизвести с помощью компьютера тысячу лет ее эволюции, синтезировать результат и оплодотворить им живую кобылу. Будет ли родившийся жеребенок, таким образом, на тысячу лет более продвинутым, чем его мать? Или, возможно, мы сможем создавать бактерии, которые поглощают из атмосферы CO2 и вырабатывают нефть. Отчасти это уже стало реальностью: ученые могут секвенировать полный геном бактерии, внести с помощью компьютера необходимые поправки, синтезировать физическую версию, имплантировать ее в свободное ядро другой бактерии и наблюдать за тем, как эта клетка превращается в искусственный организм [14]. Но они до сих пор используют в качестве отправной точки ДНК уже существующих форм жизни. Исследователи не до конца разобрались, каким образом разные уровни биологической системы контактируют и разрабатывают с нуля свой собственный организм, – пока.

Конечно, самая могущественная сила – это изменение человеческого организма. Понемногу, жестко контролируемым образом, наука уже приступила к решению этой задачи. Контроль в этой области является добровольным, ученых сдерживают только политические и этические ограничения. Технология для более агрессивного вмешательства в человеческую природу уже существует. Например, в апреле 2015 г. китайские ученые отредактировали (с переменным успехом) геномы 86 человеческих эмбрионов, чтобы модифицировать ген, отвечающий за смертельную болезнь крови [15]. Если мы решим продолжить эту линию исследования, то сможем в один прекрасный день создать новую версию человека, более развитую версию нас самих: здорового и сохраняющего активность далеко за пределами привычной продолжительности жизни, обладающего физическими и познавательными способностями, намного превосходящими наши собственные. Наша уверенность в собственных генетических и химических возможностях растет, как долго мы будем продолжать отказывать себе в этих полномочиях? И при каких обстоятельствах мы в конце концов решим употребить их? Философ Джулиан Савулеску из Oxford Martin School предположил, что эти обстоятельства, возможно, уже наступили: ради нашего собственного выживания, спрашивает он, не следует ли нам попытаться перепрограммировать поведение человека на генетическом уровне, чтобы сделать себя более спокойными и менее эгоцентричными? [16]. Разве история не показывала раз за разом, что мы плохо приспособлены для сосуществования друг с другом?

Может быть, это правильно. А может быть, и нет, и усовершенствование человека расколет мир глубже, чем любая война. Кто будет решать этот вопрос? Будет ли это частный сектор? Ученые? Правительство? Что делать, если в одних странах усовершенствование человека будет разрешено, а в других нет?

В первые десятилетия Нового Ренессанса науки о жизни внезапно и бесповоротно вложили в человеческие руки величайшую силу природы – способность создавать и изменять жизнь. Сейчас это грубая и неочищенная сила, но она растет гораздо быстрее, чем наше понимание ее особенностей и учреждения, необходимые, чтобы ее контролировать. Это волнующий – и опасный – момент. Он поставит нас перед самым серьезным выбором, с которым мы как биологический вид когда-либо сталкивались.


Естественные науки: от уменьшения до увеличения масштаба


То же самое, но меньше

Если бы Альбрехт Дюрер (1471–1528) зашел в один из цехов компании Intel по производству полупроводников, происходящее показалось бы ему на удивление знакомым. Знаменитый немецкий художник и интеллектуал, Дюрер одним из первых применил технику травления по металлической пластине. Он брал плоскую железную пластину, покрывал ее лаком, затем процарапывал на ней рисунок острой иглой, после чего погружал пластину в кислоту, которая разъедала железо в местах царапин, и таким образом переносил рисунок на металл. Этот процесс в целом совпадает с тем, с помощью которого мы сегодня создаем транзисторы на микросхеме. Железо мы заменили кремнием, а иглу художника – ультрафиолетовым лучом, но концепция осталась неизменной.

Основное различие заключается в масштабе. Дюрер вытравливал на металле тонкие линии менее чем в миллиметре одну от другой – мы гравируем на кремнии компоненты в миллион раз тоньше. Мы делаем это потому, что одно из основных правил инженерного дела гласит: если можно сделать то же самое меньшего размера – это хорошо. Меньше значит дешевле, потому что потребуется меньше сырья и материалов. Меньше значит энергоэффективнее, потому что необходимо преодолевать меньше инерции и силы трения. Кроме того, меньше значит быстрее, потому что подвижным деталям приходится преодолевать меньшее расстояние. Это простая физика.


Тот же принцип, но в миллион раз меньше

Эпоха открытий

а) Гравюра на железной пластине

Альбрехт Дюрер (1518). Пейзаж с пушкой.

Из собрания Британского музея


Эпоха открытий

б) Гравированная кремниевая пластина

Фото: Eric Gorski (2010)


Закон Мура и связанное с ним семидесятилетнее свободное падение вычислительных затрат является лучшим подтверждением пользы уменьшения масштаба в естественных науках. Компьютер производит вычисления с помощью набора переключателей, каждый из которых может находиться в положении «вкл» или «выкл», единица или ноль. Чем больше таких переключателей мы можем уместить в одном пространстве, тем больше вычислений можно будет сделать в секунду. Первые переключатели, вакуумные трубки, были размером с большой палец; в 1946 г. 20 тысяч таких переключателей заполняли помещение размером в две трети теннисного корта. В 1950-е гг. инженеры заменили трубки отдельными транзисторами размером с ноготь – 10 тысяч таких транзисторов заполняли шкаф размером с холодильник. В 1960-е гг. ученые догадались, как можно гравировать транзисторы непосредственно на кремнии. К 1970 г. на одном ногте могло уместиться более 2000 транзисторов, к середине 1980-х гг. – 20 миллионов. Современные транзисторы стали еще в 50 раз меньше, их размеры достигают всего 10–30 нанометров (миллиардных долей метра). На одном ногте легко поместился бы миллиард таких транзисторов, а 5 миллионов могли бы заполнить точку в конце этого предложения, вот здесь [17]. Каждый из них является действующим электромагнитным переключателем. Пропустите через него поток электронов, и это единица; отключите поток электронов, и это ноль.

В 1965 г. Мур предположил, что его эмпирический закон будет сохранять силу в течение следующего десятилетия, – но он продержался еще полвека. На протяжении пятидесяти лет каждый раз, когда мы хотели извлечь больше мощности из наших электронных устройств, инженеры обращались к искусству гравирования, изобретенному в XVI в., чтобы найти способ сделать технику еще меньше. Но наши компьютеры все еще не способны решать широкий круг сложных вопросов в полезные сроки. Некоторые из этих вопросов старые (какой будет погода через две недели?), многие новые (сложится ли белок, который я только что синтезировал, в полезную молекулу?). Уменьшение масштаба не может бесконечно удовлетворять нашу жажду скорости. Размер самых маленьких атомов 0,05 нанометра; это фундаментальный предел уменьшения масштаба строительных блоков. Но задолго до того, как мы подойдем к этому пределу, в масштабе примерно около 10 нанометров знакомая нам физика прекращает действовать, и ей на смену приходит другой набор правил – квантовая механика.


Физические пределы

С точки зрения масштаба разница между метром и нанометром такая же, как между всей планетой Земля и небольшим камешком. Раздел физики, объясняющий, как ведут себя микроскопические строительные блоки вещества и энергии – атомы, фотоны, электроны и т. п., – называется квантовой механикой. Самые ранние теоретические работы о свойствах квантов восходят по меньшей мере к 1877 г., а в XX в. знаменитые физики – Бор, Планк, Гейзенберг, Шрёдингер и др. – сделали ряд фундаментальных открытий, которые заставили ученых воспринимать мир в новых, квантовых терминах. Но лишь в последнее время мы получили возможность 1) увидеть воочию квантовые свойства, которые предсказали эти физики, и 2) манипулировать веществом на атомном уровне. Первое было безусловным успехом. Всего за тридцать с небольшим лет квантовая механика стала самой успешно подтвержденной теорией в истории науки: то, что она предсказывает, – это то, что мы находим, проникая на самый глубокий доступный нам уровень реальности.

Второе происходит не так гладко. Основная проблема, в терминах квантовой механики, заключается в том, что все вещества обладают не только частицами, но и волновыми свойствами. В больших масштабах волновые свойства можно игнорировать, но чем меньше становится масштаб, тем труднее это сделать. Представьте себе море, покрытое мелкой рябью. Если вы плывете на круизном лайнере, вы можете игнорировать эту рябь, – но если вы плывете на лодке, она может перевернуть вас.

Той рябью, которая угрожает перевернуть лодку производителей микросхем, является вероятностный характер микрочастиц, таких как электроны, потоки которых они направляют через транзисторы. В классической физике нечто либо существует, либо не существует. Но в субатомном царстве электронов, кварков и глюонов дела обстоят совсем по-другому. Электрон не занимает определенное место. Скорее он занимает все возможные места одновременно – до тех пор, пока мы на него не посмотрим, тогда он действительно находится в одном определенном месте. То, где мы находим его в этот момент, установлено не ньютоновскими законами причины и следствия, а законами распределения вероятностей. По большей части он оказывается там, где его ожидал бы увидеть Ньютон, но иногда нет.

Эта странная неопределенность полностью противоречит нашему опыту и интуиции. «Бог не играет в кости», – решительно заявил Альберт Эйнштейн, скептически относившийся к квантовой механике (на что Нильс Бор, верующий, ответил: «Эйнштейн, хватит указывать Богу, что ему делать»). Тем не менее на субатомном уровне все устроено именно так. Обычно мы не замечаем ничего странного, потому что в любой момент лишь крошечная доля субатомного материала, который составляет, скажем, эту книгу, делает что-то на самом деле маловероятное (например, проходит через вашу руку). Но иногда мы можем наблюдать эту странность на макроуровне. Самый наглядный пример – Солнце. Согласно привычным законам физики, оно не должно гореть. Температура солнечного ядра, около 15 миллионов градусов Цельсия, недостаточно высока, чтобы начать реакцию синтеза; солнечным атомам водорода не хватает энергии, чтобы преодолеть силу отталкивания, которая их разделяет. Но квантовая механика говорит: то, что атомы водорода могут воспламениться при такой температуре, всего лишь крайне маловероятно. Да, в массе своей они не могут пробиться через отталкивающие барьеры, которые их разделяют, но некоторым редким атомам все равно удается проникнуть на другую сторону. Солнце содержит так много атомов водорода, что даже крайне маловероятное случается довольно часто – достаточно часто, чтобы поддерживать термоядерную реакцию, которая освещает наше небо. Таким образом, хотя Солнце не должно гореть, оно все же горит.

По той же причине существует предел того, насколько малым может быть надежный переключатель, использующий электроны, – около 7 нанометров. Уменьшите его еще, и мы уже не будем уверены, включен ли переключатель, потому что мы так сказали или потому что группа шаловливых электронов бросила вызов классической физике и просочилась через соседний транзистор. Это маловероятно, но транзисторов на микросхеме так много, что даже маловероятное будет происходить достаточно часто, чтобы помешать ее работе.

При нынешних темпах прогресса ученые смогут достичь предела уменьшения надежного кремниевого переключателя в течение десяти лет, хотя, возможно, они выиграют одно десятилетие, если найдут замену кремнию – другой материал, который заставит электроны вести себя лучше (пока самый вероятный кандидат на эту роль – графен). Такие процессоры будут обеспечивать энергией следующие поколения потребительской техники и поисковых систем, но даже самые быстрые новые микросхемы будут все еще недостаточно быстрыми для решения многих важных проблем в полезный для нас срок. Дело в том, что они запрограммированы на поочередную проверку каждого возможного значения каждой переменной, одной за другой, и чем больше мы узнаем о нашем мире, тем больше значений и переменных мы вводим. На то, чтобы проверить их все, может уйти очень много времени. Скажем, у вас есть сто монет из ста разных стран, и вы хотите увидеть все возможные комбинации «орла» и «решки». Это 2100 возможных комбинаций – астрономическое число. Даже если ваш ноутбук в тысячу раз быстрее самого быстрого современного компьютера, ему все равно потребуются миллиарды лет, чтобы проанализировать все варианты.


Вычислительный гений

Конец кремниевого масштабирования близок – но мы и не рассчитывали, что кремний будет служить нам вечно. Его неминуемый закат означает, что нам придется изобрести новые способы хранения и обработки информации.

Вместо того чтобы и дальше уменьшать известные компоненты, работающие на микроуровне, можем ли мы увеличить масштабы необъяснимого нанофеномена? Наши нынешние компьютеры по своей природе ограничены, поскольку построены на основе упрощения – допущения, что частица либо есть, либо ее нет. На самом деле верно и то и другое, и теоретически это делает ее гораздо более емким носителем информации, чем мы привыкли думать. Если бы мы могли каким-то образом использовать способность электрона находиться в двух различных состояниях одновременно – это называется суперпозицией, – то он мог бы производить одновременно два вычисления. Два электрона могли бы выполнить четыре вычисления, три электрона – восемь, четыре – шестнадцать и т. д. Вычислительная мощность будет расти в геометрической прогрессии. Всего сотня электронов, работающих вместе, могла бы проанализировать наши 2100 комбинаций мгновенно – то есть на миллиарды лет быстрее, чем любой компьютер. Кроме того, если бы мы могли каким-то образом хранить информацию в разных состояниях электрона, то всего 300 электронов, работающих вместе, могли бы заключить в себе больше информации, чем когда-либо можно было хранить старыми способами – даже если бы мы преобразовали каждый атом во Вселенной в последовательность нулей и единиц [18].

Это теория. В последние два десятилетия мы начали воплощать ее на практике. Одним из первых примеров было решение проблемы простых чисел. Возьмем очень большое число (скажем, длиной в 250 цифр) – какие простые числа делятся на него без остатка? Ваш компьютер может анализировать варианты не один десяток лет и все равно не найти ответа – именно поэтому шифрование данных по большей части строится на основе простых числовых тестов, подобных этому. В 2001 г. исследователи построили квантовый компьютер, который успешно факторизовал число 15, разложив его на множители 3 и 5. В 2012 г. исследователи факторизовали 143 (11×13), а в 2014 г. они поставили рекорд квантовой факторизации, представив 56 153 как 233×241 [19]. Все это звучит не слишком впечатляюще, пока вы не задумаетесь о том, что такое на самом деле «квантовый компьютер»: совокупность атомов или электронов («кубитов»), на квантовых состояниях которых мы отображаем математические значения, и, когда они причудливым образом занимают все квантовые состояния одновременно, они, по сути дела, тестируют все варианты решения нашей математической задачи. Затем мы смотрим на частицы, что заставляет их все вернуться в то состояние, которое они предпочитают, и в переводе обратно на математический язык это означает правильный ответ.

Ученые доказали квантовую концепцию, теперь перед нами стоит задача увеличить ее масштаб. В 2011 г. канадская компания D-Wave Systems вывела на рынок первый коммерческий квантовый компьютер D-Wave One на основе 128 кубитов. В конце 2012 г. исследователи доказали, что кубиты можно создавать из атомов кремния – важный шаг, поскольку все, что нам известно об изготовлении крупномасштабных вычислительных устройств, по-прежнему опирается на кремний. В 2013 г. компания Google объявила об открытии лаборатории искусственного интеллекта Quantum в сотрудничестве с НАСА. Лаборатория купила компьютер D-Wave Two, работающий на 512 кубитах и способный решать некоторые виды задач в 3000 раз быстрее, чем самый быстрый из сегодняшних классических компьютеров. В 2014 г. компания IBM анонсировала новую научно-исследовательскую и опытно-конструкторскую программу (3 миллиарда долларов на 5 лет), цель которой – опробовать изготовление микросхем на основе графена и перейти к квантовой обработке данных. Осенью 2015 г. компания Intel также объявила о своем вступлении в область квантовых вычислений. Предположения различаются, но вполне можно утверждать, что к 2020 г. квантовые компьютеры смогут уверенно конкурировать с традиционными и заменят их в решении некоторых специализированных проблем.

Между тем физики начали искать возможности практического применения нового открытия. В 1990-х гг. они открыли квантовую телепортацию – грубо говоря, способ переместить небольшой фрагмент данных из одного места в другое, не перемещая его через промежуточное пространство. С тех пор они уверенно увеличивают надежность и расстояние квантового скачка, с оглядкой на то, что однажды таким образом удастся создать квантовый интернет. (По состоянию на 2015 г., рекорд дальности перемещения составляет 150 километров – это важная теоретическая веха, поскольку это также минимальное расстояние между Землей и орбитальными спутниками.) В 2000-е гг. стала реальностью квантовая криптография: теперь можно генерировать по-настоящему случайные коды доступа, которые физически невозможно предсказать, и передавать их на 300 километров, при этом получатель может абсолютно точно знать, был ли код перехвачен по дороге [20]. Коммерческие версии таких систем уже обеспечивают безопасность банковских переводов и передачу результатов всеобщих выборов. Правительственные учреждения также участвуют в разработках. В 2014 г. утечка правительственных документов США показала, что Агентство национальной безопасности готовилось создать квантовые устройства для создания и взлома кодов. В том же году аналогичное учреждение Великобритании, Центр правительственной связи (ЦПС), законсервировал один из собственных проектов, прототип системы шифрования, поскольку была доказана его уязвимость для квантовых атак [21].

В течение следующих нескольких десятилетий квантовые компьютеры могут помочь нам ответить на важные вопросы, по-прежнему выходящие далеко за рамки нашего сегодняшнего понимания: как именно разные уровни биологической системы влияют друг на друга, как возникает сознание и какой будет конечная судьба Вселенной. Они также могут преобразить нашу повседневную жизнь. Квантовые датчики обладают достаточной вычислительной мощностью, чтобы постоянно контролировать все химические вещества, присутствующие в нашей крови, – то есть проводить все доступные анализы крови в режиме реального времени и с мгновенными результатами. Получение оперативной информации о состоянии организма в режиме реального времени преобразит наши привычки, наши основные представления о здоровье и болезни и нашу систему здравоохранения.

Когда популярные технологии меняются, наша интуиция тоже меняется. Мы очень быстро привыкаем к тому, как должны себя вести предметы. Вам приходилось когда-нибудь проводить пальцем по экрану, чтобы обнаружить, что это не сенсорный экран? В этот момент разочарования вы можете мельком ощутить изменения, которые привнесут в наше мышление квантовые технологии. Возможно, в нашей повседневной жизни начнут появляться диковинные устройства – новые инструменты для зондирования, коммуникации, вычисления и обработки информации, – которые будут вести себя совсем не так, как устройства, к которым мы привыкли. Это будут непроницаемые черные ящики, пугающим образом мгновенно узнающие то, что им нужно, невзирая на расстояние и сложность. Чем больше будет таких устройств, тем менее странными и более естественными нам будут казаться квантовые модели поведения. Мы начнем более глубоко интуитивно понимать, как на самом деле устроена Вселенная. И это поможет нам быстрее разгадать больше ее секретов.


Производственный гений

Недавнее вторжение человечества в нанопространство обнажило пределы наших возможностей в вопросе обработки информации – и пообещало дать новый способ, который однажды приведет нас к самым глубоким тайнам природы. Но оно также обнажило пределы наших возможностей в вопросе создания вещей и дало новые способы манипулировать материей.

В начале 1980-х гг. ученые в Цюрихе изобрели новое устройство на квантовой основе, сканирующий туннельный микроскоп (СТМ), и впервые в истории смогли получить изображения отдельных атомов. К середине 1980-х гг. они уже могли брать и перемещать атомы по одному. Обрадованные футурологи буквально фонтанировали идеями: представьте себе крошечных нанороботов, которые создают машины и материалы с нуля, атом за атомом, с абсолютной точностью в минимальном масштабе. Некоторые фантазировали, что мы будем производить топливо из воздуха, извлекать чистую воду из жидких отходов и собирать космические корабли из песка и СО2. А слово «недостаточно» вообще исчезнет из нашего лексикона [22].

К сожалению, так же как квантовая рябь не позволяет бесконечно уменьшать кремниевые транзисторы, некоторые наноявления не позволяют нам уменьшать наши машины. Две широко распространенные проблемы нанопространства – хаотическое движение и клейкость. Хаотическое движение наблюдается и в стандартной физике – оно заставляет единственную каплю пищевого красителя заполнять собой целый стакан чистой воды. Вода может выглядеть спокойной, но на уровне наночастиц это бушующий океан сталкивающихся между собой молекул H2O. Клейкость является квантовой характеристикой – это то, что заставляет прозрачную пищевую пленку приклеиваться к салатнице и удерживает вместе две гладкие пластины стекла. Физические подробности этого явления понятны лишь посвященным, но в основном вещи прочно присоединяются друг к другу, когда их поверхности вступают в контакт. На макроуровне мы не часто наблюдаем этот эффект, поскольку большинство поверхностей, которые кажутся нам гладкими, при ближайшем рассмотрении оказываются шероховатыми, и у них слишком мало точек реального соприкосновения. Однако в нанопространстве клейкость обладает такой же всепроникающей силой, как сила тяжести на макроуровне. Из-за совместного действия этих двух явлений – хаотического движения и клейкости – пытаться построить что-либо в нанопространстве все равно что пытаться построить башню на корабле во время шторма, причем каждый рабочий, подъемный кран, болт, балка и дождевая капля покрыты слоем быстро застывающего цемента.


Новая эпоха открытий

Знакомые инженерам силы – натяжения, сжатия и т. п. – в нанопространстве не действуют, а материалы, которые они привыкли использовать для строительства, обладают другими свойствами. Углерод черного цвета, но если вы создадите лист углерода толщиной в один атом, он будет более прозрачным, чем стекло. Окружающее нас атомное пространство представлялось нам величайшей загадкой, поэтому в 1980-е гг. наука о материалах, вооружившись СТМ (сканирующими туннельными микроскопами) и другими новыми технологиями, устремилась на поиски того, что находится там, в глубине вещества, по каким правилам существует этот мир и можно ли использовать его необыкновенные качества для нашей пользы.

Прогресс был стремительным: мы увидели новые золотые города и вернулись с доказательствами. В 1990 г. в журнале Nature и дочерних изданиях было опубликовано в общей сложности 230 научных работ, посвященных наноразмерным объектам. К 2015 г. число работ превысило 11 тысяч. (Для сравнения, чтобы написать 11 тысяч научных работ на тему эволюции, потребовался 71 год [23].) На рубеже тысячелетий стали появляться первые коммерческие варианты применения нанотехнологий, а к 2015 г. тысячи таких продуктов уже образовали огромный рынок с оборотом 1 миллиард долларов [24].

Наночастицы серебра убивают бактерии. Как именно они это делают, мы пока точно не знаем, но уже выпускаем носки, плюшевых медвежат, перевязочные материалы, зубные импланты и строим станции метро с использованием материала, который помогает предотвращать болезни и ускоряет заживление. В 2015 г. ученые разработали «питьевую книгу» (бумагу, пронизанную наночастицами серебра) в качестве портативного недорогого решения для фильтрации грязной воды и превращения ее в питьевую [25]. Выяснилось, что гекконы могут бегать по стенам и потолку за счет квантовой клейкости: их мускулистые лапки покрыты миллиардами волосков наноразмера, обеспечивающих множество точек соприкосновения с любой поверхностью. Предприниматели создали синтетический аналог с помощью приемов, заимствованных из полупроводниковой промышленности, и теперь гекко-скотч может при необходимости найти применение в обороне (роботы повышенной проходимости), производстве (замена разнообразных винтов, заклепок и клеев) и даже в легкой атлетике (перчатки для американского футбола, не дающие игроку уронить мяч). Другие открытия будут иметь более широкое влияние. Ученые работают, например, над искусственным фотосинтезом, чтобы получать топливо из солнечного света и СО2, над ускорением процесса секвенирования ДНК (идея заключается в том, чтобы пропустить одну молекулу ДНК через крошечное отверстие, способное чувствовать электрическую разницу между проходящими сквозь него A, C, G и T) и изготовлением супертонких нервущихся презервативов из нановолокон.

Один из самых универсальных материалов, пришедших к нам из нанопространства, – графен, впервые полученный в 2004 г. Графен представляет собой лист чистого углерода толщиной в один атом. Мы хорошо знакомы с другими формами углерода – алмазом, самым твердым из существующих материалов, и графитом, настолько мягким, что мы делаем из него карандашные грифели. Графен сочетает в себе все эти достоинства. Он прозрачен и тверд как алмаз, но вместе с тем из него можно свивать гибкие волокна (достаточно прочные, чтобы дотянуться до космоса) и разреза́ть его на любые двумерные формы по нашему желанию (скажем, сворачивающийся дисплей или солнечные батареи). Он проводит тепло в 10 раз лучше, чем медь, и электричество в 100 раз лучше, чем кремний (вызывая бурный восторг у производителей микросхем). Пока еще достаточно дорогой материал, графен быстро завоевывает свое место в макрореальности. В первый год после открытия графена ученые ценой немалых усилий смогли произвести графеновый лист, шириной немного превосходящий человеческий волос. Прошло менее десяти лет, и они могут печатать идеальные рулоны графена длиной до 100 метров.


Объединяющий прорыв

Однако ученым до сих пор не удавалось собрать полезный объект из отдельных атомов или построить робота, который сможет сделать это за нас. Большинство наших сегодняшних приемов работы с нанопространством связано с матричными материалами: мы профилируем поверхность с помощью УФ-лазеров (гекко-скотч), подаем специально подготовленный пар на медный лист для получения на его поверхности тончайшей пленки (графен), смешиваем химические вещества в пробирке для получения желаемой молекулы по одному лабораторному стаканчику за раз (наночастицы серебра) и т. д. 3D-печать, которая может значительно сократить время и отходы обычного макропроизводства, на микроуровне способна пока лишь на выполнение отдельных задач – ее достаточно для печати тонких деталей аэрокосмической промышленности, но недостаточно, чтобы воспользоваться необычными свойствами материи, возникающими при тысячекратном обратном масштабировании. Кроме того, наша способность строить роботов – изготовление и монтаж двигателей, шестерней, манипуляторов и других механических частей – в микронной области по-прежнему стоит на месте. Ученые разработали несколько теоретических способов передвижения наноробота, позволяющих избежать урагана хаотичного движения и клейкости, но создание прототипа и тестирование таких роботов, возможно, произойдет лишь через несколько десятилетий – или никогда.

Для создания настоящих наномашин, скорее всего, потребуется совершенно иной подход. Как и в случае с компьютерами, вместо того чтобы пытаться уменьшить микромеханизмы до наноразмера, мы должны будем задействовать уникальные свойства нанореальности и разработать такие машины, которые будут родными в этой среде.

Один из перспективных подходов заключается в имитации биологии. Самый потрясающий инсайт, до настоящего времени полученный нами из нанопространства, заключается в том, что чем глубже мы заходим, тем более размытыми становятся границы между естественными науками и науками о жизни. Традиционно инженерная мысль не подражает природе. Самолеты не машут крыльями. Но на пересечении этих двух областей в настоящее время происходит самая плодотворная научная работа. Инженеры создают инструменты и платформы для исследования нанопространства, природа создает бесконечный каталог элегантных решений инженерных задач, с которыми мы там сталкиваемся.

Природа, как выясняется, и есть абсолютный инженер нанопространства. Бактерии, некоторые всего лишь 200 нанометров длиной, во многих отношениях и есть наноботы, которых мы так хотели бы научиться создавать [26]. У них есть крошечные энергоблоки, работающие на сахаре. У них есть устройства для сборки молекул, которые называются рибосомы, размером всего 20 нанометров. Они поддаются программированию, при этом материнской платой для них служит ДНК. Они самовосстанавливаются, самовоспроизводятся и успешно передвигаются в хаотичной клейкой наносреде, совершая продуманные вращающиеся движения.

Еще интереснее для человеческих инженеров то, насколько они непохожи на наших вожделенных наноботов. Бактерии не являются машинами общего назначения. Они узкоспециализированы: каждый вид использует особые свойства вещества в наномасштабе и умеет хорошо делать одну конкретную вещь. И они самоорганизуются с помощью неявных сил, действующих в нанопространстве. Основным приемом самостоятельной сборки является сворачивание белка. Белок начинается с отдельных аминокислот, каждая размером 1 нанометр, объединенных в длинную цепочку рибосомой клетки. Оказывается, каждый вид аминокислот (в жизни встречается всего 23 вида, и они часто повторяются) имеет уникальный электрический заряд. По мере того как цепочка становится длиннее, каждый ее блок привлекает или отталкивает другие блоки в соответствии с их зарядом, и двумерная цепь изгибается, образуя трехмерную структуру, внутри которой поддерживается сложный баланс этих сил. Это переплетение обладает нужной формой и всеми необходимыми поверхностями для того, чтобы строить структуры или вступать в полезное взаимодействие с другими белками.

Можем ли мы таким же образом собрать собственные наноструктуры? Зная, какую форму или функцию мы в конце концов хотим получить, можем ли мы разработать эквивалентное переплетение и, распутывая его, дойти до изначальной цепи аминокислот?[21] Результаты лабораторных исследований на сегодняшний день говорят, что это возможно. В 2010 г. ученые уговорили ДНК сложиться в своеобразные корзинки с замком на крышке и поместили внутрь этих корзинок молекулы лекарственного средства [27]. Подходящий ключ от замка имеют только раковые клетки. Если корзинка сталкивается с такой клеткой, крышка отлетает и лекарство немедленно высвобождается. Такой «ДНК-нанобот» может однажды заменить химиотерапию и другие современные методы лечения рака, которые убивают множество здоровых клеток вместе с больными.


Медицина заимствует у природы способность моделировать жизнь; инженерия – способность моделировать вещество. Это не обычный прогресс, это революция, которая происходит, когда мы достигаем внешних границ нашей нынешней парадигмы и принимаем новые.

Если история может служить примером, этот прорыв приведет нас в эпоху стремительного роста человеческих достижений. Появление некоторых из них мы уже наблюдаем в виде новых технологий. Некоторые победы пока остаются умозрительными. Сможем ли мы понять, как работает мозг, и создать лекарство, способное регенерировать его, так же как мы научились регенерировать другие органы? Сможет ли искусственный интеллект повторить или превзойти познавательные способности человека? Никто не знает ответа, но эти вопросы уже не кажутся такими непостижимыми, как раньше.

Мы не в силах заглянуть на пятьсот лет в будущее, но мы можем быть уверены, что, когда история XXI в. будет написана, ее заглавной темой станет освоение человеком созидательных возможностей, равных природным, – а также осмотрительность или безрассудство, которые мы при этом проявили.

Формула расцвета гения

Расцвет гения произошел не сам по себе. Это случилось в конкретных социальных и интеллектуальных условиях, которые позволили творческому потенциалу засиять еще ярче. Почему блеск гения был таким ярким именно в эпоху Возрождения? И почему это происходит сейчас?

Отчасти это заслуга редких людей – гениев, – которые родились в рассматриваемую эпоху. Индивидуальность является важнейшим компонентом каждого случая гениальности. Как отмечает Брайан Артур, один из ведущих мыслителей сегодняшнего мира, момент озарения, когда новый принцип опрокидывает старый, «всегда берет начало в глубинах индивидуального подсознания» [28]. Необычные или уникальные свойства внимания человека склоняют чаши весов в его сторону, позволяя ему совершить прорыв. Коперник сосредоточился на поиске в небесах более чистой гармонии, чем та, что была описана Птолемеем. Леонардо сосредоточился на изучении оптики и инженерного дела. Микеланджело сосредоточился на мраморных блоках, в каждом из которых, как он полагал, была заключена фигура, умоляющая об освобождении. И когда такая сосредоточенность вызывает момент озарения, его результат становится зримым воплощением уникальности автора.

Но наличие широко мыслящих и сосредоточенных умов само по себе не гарантирует расцвет гения в масштабах всего общества. Если бы это было так, западноевропейская цивилизация в 1450–1550 гг. никогда не смогла бы догнать, а затем и перегнать Китай. Китай имел значительную фору в развитии технологий, а если предположить, что люди выдающегося ума составляют постоянный процент населения во всем мире, то в распоряжении Китая было в два раза больше таких людей.

Скачок вперед, совершенный Европой в эпоху Возрождения, позволяет предположить, что в нем играл важную роль еще один фактор: коллективный гений. Каждый человек обладает уникальным фрагментом способностей, а коллективный гений рождается, когда общество бережно взращивает и подталкивает друг к другу тех, кто обладает этими отдельными фрагментами. Разнородные умы, работающие над решением проблемы, могут ронять искры оригинальных идей и делиться наработками, благотворно влияющими на общее продвижение. Возможно, количество гениев представляет собой постоянный процент от количества населения во всем мире, но коллективный гений широко различается в зависимости от социального уровня, образованности и связей.

«Всюду мы видим ученых людей, образованнейших наставников, обширнейшие книгохранилища, так что, на мой взгляд, даже во времена Платона, Цицерона и Папиниана было труднее учиться, нежели теперь»[22], – писал в 1530-х гг. французский писатель Франсуа Рабле (1483–1553) [29]. Биографии людей, совершивших самые значительные прорывы предыдущего Ренессанса, показывают, что все их выдающиеся достижения были сделаны благодаря пронизанной взаимосвязями, стремительно развивающейся эпохе, в которую они родились, и коллективному гению, процветавшему в этих условиях.

Леонардо да Винчи – самый известный всесторонне образованный ученый из Тосканы, которого помнит история, но он был далеко не единственным. Ранний гуманист Петрарка (1304–1374) тоже был родом из Тосканы, и задолго до рождения Леонардо тосканские инженеры поняли, что могут извлечь много пользы из общения со студентами Петрарки, изучавшими античную Грецию и Рим. Храмы и купола античного мира сохранились, а дорогами можно было пользоваться и полторы тысячи лет спустя. В чем заключался секрет древних? Способность творчески сочетать инженерные решения прошлого с существующими техническими проблемами или сообщать об этом в чертежах уже высоко ценилась и быстро распространялась в том месте и времени, где родился Леонардо. Леонардо достиг в этом искусстве новых высот, отчасти потому, что ему посчастливилось жить в тот момент, когда сумма знаний о прошлом и скорость распространения новых решений стремительно возросли.

Майнц, родной город Гутенберга, был центром двух очень разных производственных отраслей: виноделия и чеканки монет [30]. В первой отрасли имелось множество разновидностей прессов для винограда и инженерные навыки для работы с ними. Во второй – навыки металлообработки, изготовление форм и эксперименты со сплавами, к которым Гутенберг обратился в поисках подходящего материала для изготовления литер – легкоплавкого, принимающего нужную форму при отливке и достаточно прочного, чтобы выдержать многократное давление в типографском прессе. Эти важные промыслы были давно известны местным мастерам, но после того, как Гутенбергу удалось успешно сочетать их друг с другом, за распространение печатного станка взялись более могущественные силы, о которых мы говорили в части I (несмотря на собственные усилия Гутенберга сохранить технологию в тайне).

Что касается Коперника, он сделал свое новаторское открытие в Вармии, тихой польской области, которую он сам называл самым уединенным уголком Земли [31]. Но годы становления, от 18 до 30 лет, он провел, переезжая из одного крупного европейского образовательного центра в другой. В 1491 г. он поступил в Ягеллонский университет в Кракове, где в течение трех лет изучал логику, поэзию, риторику и философию вместе с другими талантливыми молодыми людьми со всей континентальной Европы. Там же он познакомился с главными научными трудами прошлого и настоящего, которые стали широкодоступными благодаря книгопечатанию: древней геометрией Евклида и современной тригонометрией Региомонтана, классической астрономией Птолемея и новыми астрономическими таблицами Пурбаха, а также главными трудами арабских ученых в переводе на латынь [32]. (Возможно, последнее сыграло в его открытии ключевую роль. Гелиоцентрическая модель Вселенной была впервые предложена греческим ученым Аристархом в III в. до н. э. Европа забыла Аристарха, но арабские ученые его не забыли. Быть может, Коперник черпал вдохновение именно в их трудах [33].) В 1496 г. он переехал в Италию и провел следующие семь лет в общении и сотрудничестве с самыми известными учеными континента. Именно благодаря этой сети знакомств Коперник изменил взгляд мира на небеса. Его книга «О вращении небесных сфер» (1543) была запрещена церковью. Его научного преемника, Галилео Галилея, преследовала инквизиция, обвиняя в еретических взглядах. Но когда Коперник еще в 1510-х гг. опубликовал наброски своих идей и познакомил с ними круг своих друзей-ученых, он выпустил в свободный полет идею, которую невозможно было удержать взаперти.


Стремительный поток идей, умов и стимулов

Множество книг было написано о том, при каких условиях гений расцветает в одних случаях и местах и почему в других обстоятельствах этого не происходит, однако подробное обсуждение этой темы выходит за рамки нашей книги. Вместе с тем приведенные выше истории позволяют выделить три условия, которые подготовили Европу XV–XVI вв. к коллективному расцвету (и которые, как утверждают современные ученые, играют решающую роль и сегодня).

Первое условие – резкое повышение скорости, разнообразия и насыщенности потока идей. Это очевидный, но важный момент: чем активнее поток идей, тем больше возникает новых плодотворных сочетаний идей. Разнообразие также имеет большое значение, поскольку, как выяснил Гутенберг (и подтверждают современные исследования), крупные скачки, как правило, происходят на стыке на первый взгляд совершенно не связанных между собой областей [34]. И чем насыщеннее поток, тем сложнее может оказаться результат. «Пусть никто, не знакомый с математикой, не читает моей работы», – писал Леонардо да Винчи: он считал, что лишь образованный человек способен по достоинству оценить его научные построения [35].

Часть I показала, какие соединительные силы вызвали этот скачок. Новые контакты между цивилизациями, расширение торговых и финансовых связей, повышение социальной мобильности, урбанизация и миграция вместе создали гораздо больше точек соприкосновения между разными людьми с самым разным образом жизни. И тогда и сейчас один из лучших способов раздвинуть границы нашего мышления – встретить людей, которые думают по-другому.

Самым непосредственным катализатором расширения потока идей была новая технология – книгопечатание. Печатный станок стал, как мы сказали бы сегодня, «технологией общего назначения» [36]. В отличие от, скажем, скрипки, появление которой радикально преобразило музыку, но почти не затронуло жизнь за пределами музыкальной сферы, книгопечатание повлияло практически на все виды деятельности. Оно умножило имеющийся объем знаний и расширило сеть людей, которые применяли эти знания на практике во всех областях. Среди ученых средневековая традиция написания писем друзьям и проведения местных диспутов уступила место публикации брошюр, пригодных для широкого распространения и широкой критики. Увеличение числа участников принесло в обсуждение каждой важной задачи более широкий набор знаний, опыта и идей.

Книгопечатание помогло распространить еще одну технологию общего назначения – математику. В 1494 г. Лука Пачоли издал в Венеции свой труд «Сумма арифметики, геометрии, отношений и пропорций» (Summa de Arithmetica, Geometria, Proportioni e Proportionalità e della Divina Proportione), с которого началось массовое распространение арифметики в Европе. До распространения книгопечатания с индо-арабскими числительными были знакомы только ученые представители знати. Математические действия выполняли с помощью римских цифр и абака, а потребность в упомянутом оборудовании означала, что многие люди не могли позволить себе решать арифметические задачи. Распространение арифметики сделало математику доступной для каждого, кто мог взять в руку кусочек угля, и умножило количество людей, способных понимать, выражать и развивать с помощью цифр сложные идеи [37].

Второе условие, которое помогло расцвету коллективного гения, – резко возросшее число образованных людей, регулярно получающих новую пищу для ума и способных извлечь пользу из расширившегося потока идей. Огромное количество усилий неизвестных предшественников предвосхитило открытие Коперника: это были преподаватели и мастера, негласно передававшие неписаное ноу-хау студентам и ученикам; те ученые, чьи исследования зашли в тупик, показав остальным, что здесь больше нечего искать; технические усовершенствования устройств и инструментов, которые дали возможность заглянуть глубже в тайну; бесчисленные дебаты, устные и письменные, опровергавшие точку зрения других и позволявшие точнее сформулировать собственное понимание ремесла или направить мысль в новом, неожиданном направлении. Чем больше появлялось умов, которые понимали ремесло и стремились раздвинуть его пределы, тем больше становилась вероятность того, что кому-то это в конце концов удастся.

Третье условие, которое помогло коллективному гению расцвести в ренессансной Европе пышнее, чем в других местах, – частные и социальные стимулы, вознаграждавшие риск. Китай представлял собой монолитное бюрократическое государство. В нем не существовало рынка для идей помимо утвержденных государством, а перспективные предприятия – такие, как морские экспедиции Чжэн Хэ в 1405–1433 гг., предпринятые с целью исследования Индийского океана и Восточной Африки, – вполне можно было отменить императорским указом. Европа, напротив, состояла из множества маленьких слабых государств. Конкуренция и внутренние войны (а также борьба с наступающими османами) побуждала каждое из них вкладывать деньги в открытия, которые могли бы дать ему военное, экономическое или культурное преимущество. Спрос на новое оружие, военные корабли и оборонительные сооружения был велик, и люди охотно развязывали кошельки перед теми, кто мог все это создавать (Леонардо посвятил немало лет своей долгой и насыщенной жизни проектированию военной техники) [38]. Богатые города открывали новые школы, университеты и профессорские кафедры, где искали решения коммерчески важных проблем (например, способ вычисления долготы в открытом море). Вместе с тем богатые семьи вкладывали деньги в новое искусство, скульптуру и архитектуру: это помогало формирующемуся классу богатых купцов приобрести лоск и солидность, кроме того, это был один из немногих социально приемлемых способов щегольнуть своим богатством [39].

Развивающимся рынком идей двигал не только спрос, но и предложение – люди, которые могли предложить что-то стоящее, без труда получали за это прибыль. Чудо-машину Гутенберга начали воспроизводить так быстро и в таких масштабах, что ему не удалось заработать на ней никаких денег, но следующему за ним поколению изобретателей повезло значительно больше. В 1474 г. Венеция приняла первый в мире акт патентного законодательства. Как отмечается в преамбуле этого закона, если «надлежащие меры будут приняты для защиты работ и устройств, открытых человеком выдающихся способностей… больше людей смогут употребить свои способности… и создать устройства великой полезности для нашего сообщества» [40]. К середине XVI в. такие меры стали обычным явлением во всей Европе.


Мы снова готовы

Такие же условия сложились сейчас, только их размах и влияние на этот раз шире. В части I мы привели основные доказательства. Развивающие силы сегодня вывели общую численность здорового и образованного населения в мире на самый высокий в истории уровень. Соединяющие силы – в вопросах политики, торговли, финансов, миграции населения – соединили человеческое сообщество множеством нитей. Эти же силы повлияли на распространение идей. Объем, разнообразие и богатство идей, протекающих через клубок человеческих связей, многократно увеличились.


Новые технологии общего назначения

Новые технологии общего назначения в очередной раз сделали массовые коммуникации дешевыми и легкодоступными. Увеличение вычислительной мощности компьютеров привело к тому, что поток идей стал более разнообразным и обильным, сложность того, что мы можем сказать друг другу, заметно повысилась. Благодаря совокупному росту вычислительной мощности, сформулированному в законе Мура, смартфон, который сегодня помещается у вас в кармане, быстрее, чем суперкомпьютер Cray-2, в 1990 г. считавшийся самым мощным в мире, который весил 5500 фунтов и стоил 35 миллионов долларов [41].

Закон Мура сделал интернет обычным явлением в нашей жизни, и он же приблизил нас к краю Вселенной. Последние двадцать лет вычислительная мощность неуклонно возрастала и наши разговоры касались более глубоких и сложных вопросов математики, астрономии, биологии, инженерии, геологии, метеорологии, войны, экономики и т. д. Вслед за нашими обсуждениями возникли целые новые отрасли промышленности, и сегодня мы работаем с идеями, которые пару десятков лет назад были за пределами нашего понимания. Гидроразрывная промышленность использует сегодняшние суперкомпьютеры, чтобы смоделировать, что произойдет, если пробурить в земле множество отверстий и под высоким давлением ввести жидкость, чтобы выпустить газы, запертые внутри скальной породы. Медицинская наука работает над имитацией деятельности мозга, чтобы понять, как работает мозг и как можно изменить его работу с помощью лекарственных препаратов и хирургического вмешательства. Министерство здравоохранения имитирует распространение пандемии, чтобы получить представление о том, где расположены районы максимального риска, какие узлы транспортных систем необходимо перекрывать в первую очередь и как далеко может распространиться вирус, прежде чем мы найдем вакцину, запустим ее в массовое производство и обеспечим ею всех нуждающихся. Инженеры моделируют нагрузку на новые суда, вдвое больше тех, что были построены ранее, и на небоскребы в два раза выше прежних (высота Королевской башни в Саудовской Аравии, окончание строительства которой запланировано на 2018 г., составит один километр). Создатели фильмов наделяют жизнью вполне убедительные флуоресцентные планеты, черные дыры, инопланетных роботов и мутантов-супергероев.


Новые точки соприкосновения

Свободный поток идей сегодня выражается еще и в огромном количестве точек соприкосновения между различными народами, продуктами и образами жизни.

Это особенно заметно в научном сообществе. Во всем мире около 3 миллионов студентов каждый год выезжают за границу для краткосрочного и среднесрочного пребывания. В ОЭСР две трети иностранных студентов приезжают из развивающихся стран, при этом быстрее всего растет число студентов из Азии. Тридцать лет назад Китай практически не посылал студентов за границу, а сегодня он посылает их больше, чем любая другая страна.

Если выдается возможность, многие успешные иностранные студенты, закончив обучение, предпочитают не возвращаться на родину и вносят вклад в экономику принимающей страны. В 2011 г. опрос показал, что в 10 ведущих университетах США, выдающих патенты, три четверти всех зарегистрированных патентов принадлежат иностранным изобретателям [42]. Другие выпускники конкурируют на мировом рынке исследовательских талантов. Более 40 % научных сотрудников Оксфордского университета – иностранцы родом почти из 100 стран, и этот показатель растет.

Научные мигранты распространяют и соединяют интеллектуальную мощь мира. Международное научное сотрудничество, на долю которого в 1995 г. приходилось менее 0,1 всех опубликованных работ, в настоящее время выпускает почти треть всех научных работ [43]. Самый яркий пример сотрудничества в академической истории – доклад физиков, выпущенный в мае 2015 г. и посвященный экспериментам на Большом адронном коллайдере в Женеве, он насчитывает 5154 соавторов со всего мира [44]. Поиск средства от рака в настоящее время превратился в круглосуточную научно-исследовательскую работу виртуальной команды ученых из ведущих лабораторий по всему миру. В конце своего рабочего дня они передают полученные результаты коллегам из следующей временной зоны, а утром снова начинают с того места, где остановились их зарубежные коллеги. Из 15 последних Нобелевских премий в области науки все, кроме двух, были присуждены международным группам исследователей [45].

Более свободный поток идей особенно заметен в торговле такими товарами, как фармацевтические препараты, химикаты, оборудование, компьютеры и другая электроника. За последние 20 лет торговый оборот в сфере наукоемкой продукции вырос в четыре раза в номинальном выражении, с 1,4 триллиона долларов в 1995 г. до 5 триллионов долларов сегодня. Но торговля еще и распространилась намного шире, чем раньше. В 1995 г. развитые страны продавали три четверти и покупали две трети всей высокотехнологичной продукции. Сегодня они почти пополам делят торговый оборот (как продажи, так и покупки) с развивающимися странами. Знания, необходимые для производства таких товаров, передаются по всему миру [46].

И наконец, скорость и насыщенность потока идей особенно ясна на примере социальных сетей. В Twitter четверть «последователей» обычно не из той страны, где проживает тот, на кого они подписаны. Разговоры в Facebook связывают все регионы мира. В результате массовая культура распространяется все быстрее и дальше. В 2003 г. по планете прокатился один из первых интернет-мемов, Star Wars Kid («парень из Звездных войн»). В течение трех лет это видео было просмотрено примерно 900 миллионов раз [47]. В 2015 г. канал PewDiePie на YouTube ставил рекорд за рекордом – 900 миллионов просмотров каждые три месяца [48]. Канал, созданный шведом Феликсом Чельбергом, который с шутливыми комментариями рассказывает о своем опыте прохождения видеоигр, в конце 2015 г. стал первым, преодолевшим отметку 10 миллиардов просмотров. Ранее в том же году исламские экстремисты ворвались в редакцию сатирического еженедельника Charlie Hebdo в Париже и убили 12 человек в отместку за размещенные на страницах издания карикатуры на пророка Мухаммеда. В течение 24 часов хештег #JeSuisCharlie, задуманный как способ поддержать свободу слова, получил 3,4 миллиона ретвитов во всех странах мира, где Twitter не был заблокирован [49].

Внезапно в мире оказалось очень много здоровых и образованных людей, которые все активнее обмениваются разнообразными яркими идеями, распространяя их по всему миру мгновенно и почти бесплатно. Эти условия идеально подходят для творческих свершений, как индивидуальных, так и коллективных. Они объясняют, почему большие перемены происходят именно сейчас и почему гений этого Нового Ренессанса намного превзойдет предыдущий. Если мы получим правильные стимулы (важный нюанс, о котором поговорим подробнее в главе 8), наш нынешний расцвет станет еще более впечатляющим.


Международная дружба в Facebook связывает мир.

Facebook

Эпоха открытий

5

Соборы, верующие и сомнения

Почему некогда немыслимые достижения стали обычным делом и почему все мы должны принять наступающий расцвет (хотя его последствия не всегда будут такими, как мы ожидаем)

Коллективные усилия

Заголовки сегодняшних газет и учебников истории пестрят именами гениев. Мы превозносим и воспеваем тех, кому удалось раздвинуть устоявшиеся границы. Но эти люди лишь верхушка айсберга – небольшая видимая часть намного более массивного и глубокого явления. За гением Коперника и да Винчи, Стива Джобса и Стивена Хокинга стоит нечто намного большее: распространение талантов и возможностей среди огромного количества людей.

В последней главе мы показали, какую роль в нашем нынешнем расцвете играет коллективный гений. Каждый из нас обладает уникальным разумом, и, когда условия позволяют питать, соединять и направлять к единой цели множество умов, как это происходит сейчас благодаря массовой грамотности и цифровым связям, вместе мы можем добиться прорыва, который поддержит и ускорит наши индивидуальные достижения.

Коллективные усилия – еще одна форма совместного творчества эпохи Ренессанса, и, хотя для их расцвета требуются такие же условия, их вклад в развитие общества имеет свои особенности. Гений в своих индивидуальных и коллективных формах привносит оригинальность. Как показала предыдущая глава, гений может освободить нас из плена господствующего образа мыслей и помочь нам увидеть мир по-новому. Он движет общество вперед, расцвечивая настоящее уникальностью всех ныне живущих.

Главный вклад коллективных усилий – масштаб. Коллектив может творить чудеса и решать проблемы, с которыми один человек, не важно, насколько одаренный, никогда не справится в одиночку. Есть вещи, которые можно сделать только вместе. Микеланджело спроектировал купол, венчающий собор Святого Петра, – но вознесли его наверх коллективными усилиями.

И это не единственное, что мы можем вознести.


К новым высотам

Собор Святого Петра в Риме. Севильский кафедральный собор Мария-де-ла-Седе. Собор Антверпенской Богоматери. В 1550 г. это были (именно в таком порядке) три самые высокие церкви христианского мира (собор Святого Петра и Севильский кафедральный собор до сих пор занимают первое и третье место, каждый в своем регионе). Все три были начаты или закончены в предыдущем столетии.

Большинство соборов Европы были построены в Средние века, но самые масштабные из них украсили пейзаж немного позднее. Великолепное строительство началось во Флоренции с собора Санта-Мария-дель-Фьоре, или Дуомо. На самом деле собор начали строить гораздо раньше, в 1296 г., но именно финальный этап работ, увенчание собора куполом по проекту Брунеллески, состоявшееся в 1436 г., перевел его в новый разряд коллективных достижений. Сделанный по образцу древнеримского Пантеона, гигантский купол Брунеллески громко заявлял всем, кто его видел, что в сердце Флоренции воскрешены ценности и эстетика античного мира. Кроме того, это был технологический триумф. Чтобы оценить степень инженерного развития общества, достаточно выяснить, какого размера крыши оно способно возводить без внутренних опор. Древние римляне установили высокую планку: диаметр купола Пантеона равняется 43 метрам. Купол Брунеллески (44 метра) впервые за 1300 лет смог затмить этот рекорд.

Соборы были мерилом коллективных возможностей – наглядным подтверждением того, что можно сделать сообща. История запечатлела имя Брунеллески, но он не в одиночку вознес свой купол. Над этим работало множество людей. Потребовались огромные денежные средства и несколько поколений квалифицированных рабочих, чтобы воплотить в жизнь этот амбициозный проект. То, что старый собор Святого Петра, построенный в 360 г. при императоре Константине I и простоявший почти в руинах в течение многих столетий, был разобран и перестроен (став при этом в несколько раз больше) в эпоху Возрождения, не простое совпадение. Как и то, что Севилья и Антверпен именно в этом столетии возвели два следующих по размерам Божьих дома. До того как «открытие» Колумба превратило ее в центр международной торговли с Новым Светом, Севилья была непримечательным испанским городком. Голландский портовый город Антверпен в XVI в. преобразился в главный финансовый и торговый узел Европы. Развивающие и соединяющие силы – постепенный рост богатства, улучшение здоровья и образования, политическая и экономическая интеграция, а также урбанизация – вдохнули жизнь в грандиозные архитектурные проекты. «Построим же церковь такую прекрасную и такую величественную, чтобы все, кто ее увидит, думали, будто мы сошли с ума» – так, если верить местному преданию, говорили жители Севильи [1]. Так они и сделали. В 1520-е гг., когда они закончили свой сумасшедший труд, Севильский кафедральный собор потеснил с первого места собор Святой Софии в Стамбуле, почти тысячу лет считавшийся самым большим в мире, – но, в свою очередь, сохранял за собой этот титул менее ста лет.

Коллективные усилия эпохи Возрождения возвели новые храмы знания – библиотеки. Библиотеки не просто стали больше. В 1450 г. в хорошо укомплектованной библиотеке хранилась сотня рукописей, к 1550 г. у каждого ученого в личном распоряжении могло быть более ста книг [2]. Коллекции крупнейших библиотек континента стремительно выросли, от двух-трех тысяч томов до пятнадцати-двадцати тысяч [3]. Этот бум произошел благодаря изобретению Гутенберга: в первые сто лет книгопечатания было продано примерно 100–150 миллионов экземпляров книг (всего было издано 100–150 тысяч различных произведений), и многие из них осели на полках королевских, монастырских и университетских библиотек [4].

Но гораздо важнее размера и количества этих библиотек было разнообразие их содержания, и именно в этом заключается коллективное достижение. Голод, чума и войны Средневековья разбросали письменное наследие западной цивилизации по королевским дворцам и монастырям Европы. Многое было потеряно, многое из оставшегося лежало, забытое, на пыльных полках. Но появилось книгопечатание, и издатели, жаждущие получить новые материалы, начали охоту за этим разрозненным наследием – в частности за трудами классической Греции и Рима, спрос на которые они не могли насытить.

Книгопечатники стали просвещенными расхитителями гробниц. Они руководили разветвленной сетью охотников за манускриптами, простиравшейся так далеко, как позволяла эпоха, то есть, учитывая растущие экономические связи между основными населенными центрами Европы, от Атлантического побережья до Черного моря. Альд Мануций (около 1452–1515), один из самых плодовитых издателей Европы того времени и изобретатель курсива, собирал редкие рукописи из Италии, Франции, Германии, Англии, Польши и Венгрии и даже посылал за ними поисковые партии далеко на север – до самой Шотландии и далеко на восток – до современной Румынии [5]. За годы работы типография Aldine Press напечатала 120 произведений (общим числом по меньшей мере 100 тысяч экземпляров), в том числе первые издания на греческом языке более девяноста классических авторов: Аристотеля, Платона, Геродота и др. [6]. Издания Мануция продавались по всей Европе, сопровождали капитанов кораблей всюду, куда те заплывали, и заложили основу изучения классического греческого наследия во всем мире (в том числе в родном для авторов этой книги Оксфорде, где до сих пор хранятся многие бесценные первые издания Мануция) [7]. Он создал библиотеку, не ограниченную местом или временем, как великие библиотеки прошлого, и не знавшую других границ, кроме границ мира. Так, по крайней мере, считал Эразм Роттердамский (около 1466–1536), который некоторое время работал в издательской команде Альда Мануция и чья широкая сеть связей, вероятно, помогла обнаружить несколько рукописей [8].

Каждая типография вела собственный бизнес, и они конкурировали между собой, стараясь первыми выйти на рынок с очередным великим трудом Платона или Птолемея, но почти каждая новая книга появлялась ценой немалых коллективных усилий. За каждой книгой стояла команда ученых со всей Европы, усердно пытающихся собрать воедино сохранившиеся страницы рукописей и составить из них авторитетный, «годный для печати» текст [9]. Иногда эта задача оказывалась непосильной для одного издателя – как случилось со стихотворениями Феокрита, изданными Мануцием в 1496 г. Но, как заметил Мануций в предисловии к этому изданию, «немного – это лучше, чем ничего» (сегодня этот коллаборативный афоризм по-прежнему популярен среди основателей стартапов); он рассматривал труд своей команды как основу, которую могли бы улучшить и дополнить коллеги – именно это они и сделали [10].

Конкурируя и пользуясь плодами успехов друг друга, преуспевающие типографии Европы заново собрали сохранившуюся базу знаний западной цивилизации. Они копировали и распространяли знания повсюду, где на них существовал спрос, и к 1550 г. то, что когда-то было малочисленным и фрагментарным, стало доступным в полном объеме практически каждому, кто умел читать, в том числе жителям Нового Света – первая типография в Мексике открылась в 1539 г. [11]. Можно с уверенностью утверждать, что этот коллективный подвиг был самым важным интеллектуальным достижением предыдущего Ренессанса.


Современные соборы, новейшие библиотеки

Пятьсот лет спустя относительно небольшая группа людей с помощью подъемных кранов и мощной строительной техники может возвести здание в несколько раз больше собора Святого Петра и сделать это в десятки раз быстрее. Но во многих других областях масштаб по-прежнему побеждает нас – или побеждал. Теперь наши коллективные возможности таковы, что даже самые безумные проекты легко переходят в категорию достижимых.

Многие из нас хорошо знакомы с этими новыми силами: то, что всего десять лет назад было невозможным, сегодня стало обычным явлением. Современные храмы, Википедия и платформы ПО с открытым исходным кодом (Linux, Apache) были построены, клик за кликом, десятками тысяч человек. Эти люди разбросаны по всему миру, но они собираются в интернете, ведомые общими интересами, и их коллективная работа пользуется огромным спросом. Википедия практически вытеснила печатные энциклопедии; Apache обеспечивает работу 60 % всех интернет-серверов [12]. Facebook и YouTube, подобно библиотекам предыдущего Ренессанса, были собраны множеством людей и во многих отношениях представляют собой хронику человечества. Коллаборация – новое модное слово и часть нашей повседневной жизни: мерило рабочей производительности, критерий в заявках на получение гранта, приоритет корпоративной стратегии и государственного планирования, а также целая новая отрасль программного обеспечения.

С распространением мобильных информационных сетей коллаборация прочно вошла в нашу жизнь. В эпоху предыдущего Ренессанса люди шли на главную городскую площадь, чтобы найти друг друга, – в эпоху Нового Ренессанса главная площадь всегда с нами, в режиме реального времени, в виде данных о нашем местонахождении, нашей личности, предпочтениях и поведении. В любое время мы можем выйти на площадь, чтобы удовлетворить самые разные, постоянно расширяющиеся потребности: сделать покупки, поесть, заняться спортом, отправиться в путешествие или с кем-нибудь встретиться. Мы можем подбирать партнеров для любви или секса (Match.com, Tinder), соединять предпринимателей с инвесторами (kickstarter.com, indiegogo.com), водителей с пассажирами (Uber, Lyft), путешественников со свободным жильем (Airbnb), лиц, отвечающих за общественный порядок, с уличными проблемами (SeeClickFix.com), людей, нуждающихся в помощи, с добрыми самаритянами (causes.com, fundly.com), проблемы – со специалистами, которые могут их решить (хакерские марафоны, InnoCentive.com), а пострадавших – с донорами помощи (Ushahidi.com); и это лишь немногие варианты.

Ни одно из этих начинаний или форумов не могло бы существовать десять лет назад. Теперь они являются неотъемлемой частью нашей жизни, с их помощью мы общаемся, учимся, создаем, обмениваемся, делаем и помогаем, и делаем все это быстрее, эффективнее, с большим размахом и (иногда) негласно.

Однако самые амбициозные коллективные усилия нашего времени менее известны. Их цель – не помочь нам в повседневной жизни, а победить давно устоявшиеся ограничения, сковывающие человеческую цивилизацию и науку, – рубежи, которые не смогли раздвинуть даже наши неуклонно растущие вычислительные ресурсы.

Первый рубеж – это язык, который делит человеческую культуру и знания на обособленные острова. Английский, сегодняшнюю lingua franca, понимают лишь 25 % населения мира, причем с разной степенью успеха [13]. Чтобы внятно объясниться с половиной человечества, вы должны говорить на четырнадцати языках, а чтобы вас поняли три четверти человечества – на сорока языках [14]. Интернет, главное средоточие человеческого общения и общая сокровищница знаний, точно так же разделен языковыми стенами: то, что мы видим, зависит от языка, которым мы пользуемся. Англоговорящие пользователи имеют доступ к более богатому резервуару. Половина твитов в мире и бо́льшая часть научных исследований в интернете написаны на английском [15]. Английская версия Википедии, насчитывающая 5 миллионов статей, в 2,5 раза превосходит следующую по величине немецкую Википедию, насчитывающую 1,9 миллиона статей, и более чем в 15 раз превосходит в среднем 50 других ведущих изданий [16]. С другой стороны, английские пользователи почти ничего не знают о крупных явлениях и событиях неанглоязычного интернета, таких как китайские социальные сети (основные платформы обмена сообщениями Weibo и Weixin намного опережают Twitter по количеству пользователей и объемам общения) [17] или Нолливуд (Голливуд Нигерии, чье мобильное видео помогло ему вырасти во второй по величине центр кинопроизводства в мире, уступая лишь индийскому Болливуду). В совокупном итоге, хотя международный трафик с 2005 г. вырос примерно в двадцать раз, лишь половина этих потоков покидает регионы, в которых они были созданы [18]. Это намного меньше международного оборота товаров (68 %) – материальным предметам в меньшей степени препятствуют языковые и культурные расхождения [19].

Полностью многоязычный интернет станет для цивилизации по-настоящему бесценным подарком. К сожалению, это до сих пор находится за пределами наших возможностей. Для того чтобы перевести хотя бы один фрагмент интернета, например полную англоязычную Википедию, всего на один широко используемый язык, потребуется не менее 100 миллионов долларов и более 10 тысяч человеко-лет [20]. Даже если кто-то готов за это заплатить, мы вряд ли найдем достаточно переводчиков, согласных сделать такую попытку, в зависимости от языка перевода. Системы компьютерного перевода отчасти помогают решить проблему, позволяя нам в общих чертах понять, что означает то или иное иностранное выражение. Но пользователи всех онлайн-переводчиков начиная с 1990-х гг. (AltaVista, Babelfish и сегодняшний Google Translate) могут подтвердить, что при машинном переводе всегда теряется часть смысла, львиная доля связности и полностью пропадает стиль. Это происходит потому, что живые переводчики сначала вникают в смысл первоисточника, а затем пытаются как можно точнее передать его на другом языке, а компьютер начинает с распознавания отдельных слов (в лучшем случае фраз) и затем склеивает их аналоги без какой-либо общей концепции. Пройдет еще несколько лет, прежде чем он научится делать это действительно хорошо.

Тем не менее идея многоязычного интернета постепенно начинает выглядеть все более правдоподобной. Раньше мы не принимали в расчет того, насколько широко среди людей распространено стремление изучать другие языки, – по недавним оценкам, таких людей в мире 1,2 миллиарда [21]. Выяснилось, что перевод фрагментов интернета – полезная практика для изучающих иностранные языки, и студенты с удовольствием пользуются ею и готовы делать это бесплатно. В результате произошел колоссальный скачок наших совокупных возможностей перевода. Особенно сильно это ощущается в сфере развлечений и другого популярного контента. В Китае голливудские блокбастеры и популярные сериалы канала HBO появляются в интернете в тот же день, когда выходят в США, вместе с субтитрами на мандаринском диалекте, которые делают фанаты, практикующиеся в английском. Для образовательного интернет-портала Khan Academy добровольцы перевели более чем на 65 языков почти все шесть тысяч учебных видео. Интернет-портал TED привлек более 22 тысяч добровольцев, чтобы перевести более 80 тысяч выступлений TED Talks более чем на 100 языков. В общей сложности в 2015 г., по нашим оценкам, количество добровольных переводчиков в мире составило от 2 до 4 миллионов человек, и в течение одного года они подарили человечеству от 25 до 50 миллионов часов бесплатных переводческих услуг в таких областях, как развлечения, образование, новости и ликвидация последствий стихийных бедствий (путем перевода твитов жертв в реальном времени для аварийно-спасательных служб).

Умные бизнес-модели определяют новые способы оптимизации наших коллективных переводческих усилий и приложения их к общедоступному контенту, который добровольцы оставляют без внимания (или к частному контенту на платной основе). Один из примеров – платформа Duolingo, разработанная доктором Луисом фон Аном, профессором информатики из Университета Карнеги-Меллон. Учебная платформа доступна в сети и в виде приложения, и она предлагает студентам, изучающим языки, переводить реальные предложения из интернета: фрагменты статей Википедии или новостных лент CNN. Когда несколько студентов переводят одну фразу одинаково, система расценивает такой перевод как достоверный, а затем отдает или продает его обратно владельцу оригинального текста. Этот способ обучения является бесплатным для пользователей, включает в себя игровой элемент и очевидно эффективен, поэтому студенты, изучающие иностранные языки, охотно им пользуются. Duolingo была запущена в июне 2012 г. и первоначально насчитывала 300 тысяч пользователей. Через три года на платформе было зарегистрировано 25 миллионов пользователей (из них 12,5 миллиона активных), изучающих 13 разных языков, еще 8 языков находились на стадии разработки [22]. Если достаточное количество пользователей Duolingo перейдет от уровня новичка до высших уровней владения вторым языком, они в короткие сроки смогут разрушить некогда непреодолимые языковые барьеры интернета. Если число продвинутых пользователей Duolingo достигнет миллиона, они смогут полностью перевести англоязычную Википедию примерно за 100 часов.

Второй масштабный рубеж, который мы коллективно преодолеваем, – анализ научных данных. «Во многих областях науки мы ограничены не тем, какие данные можем получить, а тем, что мы можем сделать с имеющимися у нас данными», – считает астрофизик Крис Линтотт [23]. Информации более чем достаточно – чего нельзя сказать о нашей способности ее обрабатывать. Наши компьютерные устройства все лучше справляются со сбором данных, которые нужны исследователям (в случае Линтотта это изображения далеких галактик), но они по-прежнему плохо умеют распознавать закономерности, которые мы ищем, и отделять значимые сигналы от бессмысленного шума. В результате огромный массив данных, ожидающих обработки, растет не по дням, а по часам. Большой адронный коллайдер ЦЕРН в Швейцарии каждую секунду производит около гигабайта новых данных о поведении фундаментальных частиц [24]. Все машины секвенирования ДНК в мире каждую секунду выдают от одного до двух гигабайт данных о том, как работают наши гены [25]. В НАСА данные буквально льются с неба: различные миссии каждую секунду генерируют около 150 гигабайт новых наблюдений о нашей Вселенной [26]. (Для сравнения, в 2015 г. более полутора миллиардов пользователей Facebook вместе загружали около 5 гигабайт данных в секунду. Можете ли вы быть в курсе новостей целого мира? Проблема НАСА в тридцать раз больше.) Такие же потоки извергаются на головы климатологов, геологов, социологов, экономистов и других исследователей, работающих с данными. Наука уже нашла ответы на многие важные вопросы. Мы просто этого еще не знаем.

Но вскоре положение изменится. Достижения коллективного гения заставили ученых признать очевидное: в то время как компьютеры с трудом распознают закономерности и отсеивают шум, человеческий мозг справляется с этим без труда. И исключать из научной работы тех, кто не одет в лабораторный халат, было ошибкой. Модернизированные современные методы исследования предоставляют компьютерам делать то, что они умеют лучше всего, и приглашают множество добровольцев приложить человеческие мыслительные способности там, где они больше всего необходимы, – «гражданская наука» начинает преодолевать узкие места, создающие досадные помехи в широком спектре дисциплин.

В 2007 г. Крис Линтотт и Кевин Шавински основали интернет-проект «Галактический зоопарк» (Galaxy Zoo), пригласив астрономов-любителей помочь каталогизировать и классифицировать около 900 тысяч галактик, фотографии которых были получены начиная с 2000 г. У одного усердного специалиста, работающего 24 часа в сутки 7 дней в неделю и 365 дней в году, выполнение этой задачи заняло бы от трех до пяти лет и вдвое дольше, если бы он перепроверял свою работу. Сто тысяч волонтеров справились с ней менее чем за полгода, при этом каждая галактика была повторно проверена в среднем 38 раз. К середине 2014 г. несколько сотен тысяч добровольцев Galaxy Zoo обработали семь гигантских архивов данных, составили каталог галактик, в десять раз превосходящий все предыдущие версии, и написали по результатам своей деятельности 44 научные работы [27]. Кроме того, они заметили редкие астрономические явления, существование которых предполагалось, но до сих пор не было подтверждено, и обнаружили другие, совершенно неожиданные, такие как Объект Ханни [28]. Это небесное тело было названо именем Ханни ван Аркел, школьной учительницы из Нидерландов, – честь, которой редко удостаиваются даже профессиональные астрономы.

В 2015 г. Galaxy Zoo расширился до Zooniverse (zooniverse.org) – крупнейшего в мире портала гражданской науки, насчитывающего 1,1 миллиона зарегистрированных добровольцев. Совместно они обрабатывают гигантские массивы данных в рамках десятков разнообразных проектов, посвященных астрономии, биологии, экологии, климатологии и гуманитарным наукам [29]. Проект под названием «Планета четыре» (Planet Four) приглашает любителей Марса помочь составить карту поверхности Красной планеты. В проекте Chimp & See любители животных помогают наблюдать за слонами, леопардами и шимпанзе, которые проходят, проносятся или качаются на ветвях перед сотнями камер, разбросанных в лесах Африки. «Старая погода» (OldWeather) просит общественной помощи в расшифровке судовых журналов, охватывающих временной период до середины XIX в. (в старых журналах собран самый полный из существующих свод долгосрочных климатических данных, но, как древнегреческие тексты во времена Альда Мануция, они пылятся, рассеянные по всему миру, в морских музеях и архивах). «Жизнь в древности» (Ancient Lives) объединяет фанатов археологии, которые помогают переводить тысячи древнеегипетских папирусов (знание иероглифов при этом необязательно). «Охотники Хиггса» (Higgs Hunters) приглашают всех желающих присоединиться к обработке данных, полученных на Большом адронном коллайдере, чтобы найти дополнительные доказательства существования бозона Хиггса и других необычных частиц.

Zooniverse – лишь одна из платформ гражданской науки. Есть и другие, например Tomnod (Tomnod.com), где добровольцы просматривают спутниковые фотографии, чтобы помочь остановить незаконный лов рыбы или найти пропавшее воздушное судно, или EyeWire (eyewire.org) – онлайн-игра, помогающая изучать человеческий мозг. Более миллиона добровольцев по всему миру принимают участие в тысячах амбициозных проектов, которые иначе не были бы возможны [30]. Гражданская наука значительно повышает эффективность самых разных отраслей традиционной науки. Результаты, на получение которых у продуктивной лаборатории ранее ушли бы десятилетия, теперь могут быть достигнуты под руководством горстки кураторов всего за несколько лет.

Однако гражданская наука не является панацеей. Для того чтобы перевести данные в массово понятную форму и курировать каждый проект, чтобы его результат выдержал пристальное внимание коллег по научному цеху, по-прежнему необходимы существенные усилия специалистов. Это не всегда возможно. Архивы данных, состоящие из изображений, звуков и необычного текста, вызывают у общественности больше интереса, чем бесконечный поток цифр, который выдают ускорители элементарных частиц. И, поскольку количество данных, которые передают наши исследовательские устройства, продолжает расти, даже исследовательским группам, насчитывающим тысячи участников, придется ускорить темп работы, если они хотят идти с ними в ногу. Гигантский радиотелескоп SKA (Square Kilometer Array), запуск которого планируется в 2020 г., будет в одиночку ежедневно генерировать столько же новых данных, сколько пять тысяч платформ Facebook [31]. Чтобы справиться с этой задачей, команда Zooniverse работает над повышением эффективности, например, предлагает отбирать самых внимательных добровольцев и реже подвергать их работу дополнительной проверке.

Платформы гражданской науки должны стать умнее, и они это сделают. Лучшее из того, что происходит прямо сейчас, – это совместная работа гражданских ученых с машинами, способными к обучению. Когда люди замечают новые галактики или отличают леопарда от гепарда, машины анализируют, как мы это делаем, и улучшают собственные алгоритмы. Это высвобождает человеческие ресурсы, которые выгоднее сосредоточить на более сложных наблюдениях. В то же время существующие платформы гражданской науки уже дали ответы на некоторые вопросы на десятки лет раньше, чем ученые предполагали их найти, и помогли решить проблемы, на решение которых мы даже не надеялись.

Коллективное сомнение

Ну и что?

Увлекаемая вперед расцветом гения, Европа XVI в. намного обогнала остальные страны мира по многим показателям прогресса, но это стало ясно лишь позднее. В эпоху, чреватую непосредственными тревогами – надвигающимися с востока турками, междоусобными распрями европейских правителей, экономическими, социальными и религиозными потрясениями, поднявшимися на волне перемен, – люди обращали мало внимания на художественные и научно-технические прорывы. Что в них было толку, если они не могли изменить жизнь людей к лучшему?

Открытие Колумбом Нового Света несколько лет продолжали считать незначительным событием, особенно когда на другой чаше весов лежал реальный приз – короткий морской путь к сказочным богатствам Азии [32]. Найденные новые земли, не поставлявшие прибыльных товаров, таких как пряности, на первых порах едва ли казались прибыльными, а их жители не обладали религией и культурой того рода, который мог бы заинтересовать европейцев. С точки зрения современников, великие путешествия на запад через Атлантику не принесли ровным счетом ничего.

Точно так же научная работа Коперника представлялась совершенно оторванной от жизненных приоритетов. Даже немногим образованным людям, которые поняли, что сделал польский ученый, революционное значение его утверждения о том, что Земля вращается вокруг Солнца, было далеко не очевидно. У него не было никаких доказательств своей «ереси» – лишь теория, в которую лучше укладывались факты. И значение его открытия в те времена было в основном эзотерическим: оно помогало астрологам точнее составлять гороскопы. Обществу потребовалось не одно и не два столетия, чтобы свыкнуться с тем, что неясный символический язык геометрии и математики способен растолковать им физическую реальность намного лучше, чем Слово Божье. Предисловие издателя к тиражу «Об обращении небесных сфер» Коперника опасливо предупреждало: «Эти гипотезы не претендуют ни на истину, ни даже на вероятность… Они публикуются не с тем, чтобы убедить кого-либо в их правдивости, а лишь для того, чтобы дать надежную основу для вычислений… И пусть никто не ожидает от астрономии той определенности, которой она не в состоянии дать, дабы не принял он как истину мысли, изложенные для других целей, и не остался, окончив чтение, еще большим глупцом, чем начинал его» [33].

Даже печатный станок Гутенберга, столь очевидно превосходящий переписывание от руки, поначалу вызывал лишь недоуменное пожатие плечами. Если вам нужно было изготовить несколько экземпляров книги, быстрее, дешевле и надежнее было обратиться к писцу. Чтобы отлить и смонтировать тысячи металлических букв, Гутенбергу требовались немалые предварительные инвестиции. Этот способ имел смысл только при изготовлении больших тиражей. Но книги были предметом роскоши: полезные немногим, принадлежавшие единицам. Какая книга могла понадобиться сразу сотням человек? (На ум сразу приходит Библия, но нет: это был особый текст, для чтения которого требовалось руководство специалистов, – не так ли?)


И снова – ну и что?

Похожие сомнения омрачают и наши сегодняшние достижения. В науке и производстве все чаще раздаются голоса, утверждающие, что ни о каком расцвете речи не идет, а прорывов и изобретений, которые важны для нас здесь и сейчас, становится все меньше.


Статистическая стагнация

Экономическая статистика представляет собой унылое упрощение реальности. Она не в состоянии измерить многие важные для нас вещи: красоту «Сотворения Адама» Микеланджело или легкость, с которой мы теперь можем заводить друзей по всему миру. Но она может измерить некоторые другие вещи, которые тоже имеют немалое значение, а именно наши доходы, а также их ожидаемый прирост. Цифры требуют прямого ответа на вопрос, которым когда-то встречали Колумба после известия о его «неудаче»: можно ли вообще говорить о расцвете гения, если он не приносит нам ощутимой выгоды?

Самый убийственный показатель – выработка за час работы или, в экономических терминах, «производительность труда». Сколько «пользы» приносит один час работы? Наш доход напрямую зависит от ответа на этот вопрос. Экономисты считают, что это хороший способ следить за техническим прогрессом общества. («Технический прогресс» в данном случае означает не только машины, но и законы, порядки и бизнес-модели.) В зависимости от того, убираю я свой урожай двуручной косой или комбайном с GPS-навигатором, этот показатель – производительность одного часа моей работы – будет сильно меняться.

В настоящий момент эти цифры вызывают тревогу. В 2012 г. известный американский экономист Роберт Гордон проанализировал производственную статистику США за сто лет и пришел к выводу, что в действительности наши последние технологические достижения не так уже велики. В первые восемьдесят лет того временного отрезка, который он исследовал, с 1891 по 1972 г., производительность труда в США росла примерно на 2,3 % в год. С точки зрения макроэкономики это потрясающая скорость (с такими показателями производительность удваивается в каждом новом поколении), а темп и продолжительность прироста доказывают, что технологические достижения действительно переменили к лучшему жизнь нескольких поколений людей. Однако постепенно перемены подошли к концу: все граждане США получили машины, электричество и чистую проточную воду. После 1972 г. производительность росла гораздо медленнее – всего на 1,4 % в год, – и экономисты ожидали следующего большого бума, который мог бы придать производительности новое ускорение [34].

К счастью, это действительно произошло. Появились компьютеры и информационные технологии, которые снова изменили трудовые отношения; к 1996 г. рост производительности бодро поднялся до 2,5 % в год. К сожалению, на этот раз все закончилось еще быстрее. Технологии распространялись стремительно. К 2005 г. в США промышленные роботы, сканеры штрихкодов, автоматизированные кассовые аппараты, персональные компьютеры и электронная коммерция более или менее охватили всю страну, и рост производительности снова упал примерно до 1,3 %. На этой отметке он и остается с тех пор. Это неприятная новость для всех: средняя заработная плата в США за сорок лет, с 1932 по 1972 г., выросла на 350 %, но в течение следующих сорока лет – только на 22 %. Другими словами, несмотря на всю шумиху, окружающую компьютеры, они повлияли на доходы населения меньше, чем смывной туалет [35].


Ожидания не оправдались

Нынешняя стагнация очевидна даже без цифр. Рассмотрим аргумент, который выдвинули Гарри Каспаров и Макс Левчин. У человека, родившегося в США в 1875 г., было три способа попасть из пункта А в пункт Б: дойти пешком, доехать на лошади или доплыть на лодке. Этот человек ежедневно вручную приносил воду и вывозил нечистоты, жег дрова или уголь, чтобы получить свет и тепло, и выполнял бо́льшую часть своей работы с помощью других людей или животных. Если он не умер преждевременно (из-за плохих санитарных условий ожидаемая продолжительность жизни в то время составляла всего 40 лет), то он прожил достаточно долго, чтобы увидеть мир, в котором люди ездили на автомобилях, летали на самолетах, вызывали поток воды одним поворотом крана, зажигали свет щелчком выключателя и использовали машины для всего, от стирки одежды до подсчета заработной платы. Он мог стать свидетелем появления электричества и всех его производных, автомобилей и системы автомобильных дорог, централизованного домашнего водопровода и системы отопления, радио и телефона, авиаперелетов, а также вакуумной трубки, пенициллина, радаров, ракет и атомного оружия. А человек, родившийся в 1950 г., мог своими глазами наблюдать зарю космической эры и появление транзисторов и компьютеров еще до того, как ему исполнилось тридцать лет.


Сегодня многие ожидания о будущем не оправдались

Эпоха открытий

Эпоха открытий

Bill Watterston (1989). Calvin and Hobbes. Печатается с разрешения Universal Uclick. Все права защищены


Все эти изобретения определили облик современности. Но вместе с тем они внушили людям уверенность, что технологии обеспечат им фантастическое будущее.

Теперь перенесемся в настоящее: эти ожидания не оправдались. За исключением нескольких дополнительных гаджетов, полированного алюминия и цифровых дисплеев, современные кухни не слишком отличаются от кухонь наших бабушек и дедушек. Современные автомобили двигаются по трассе несколько быстрее, чем раньше, – но в городах гораздо медленнее из-за перегруженности дорог. После вывода из эксплуатации самолетов класса «Конкорд» перелет из Нью-Йорка в Лондон занимает те же шесть часов, что и раньше. (Мы даже перестали летать на Луну.) Несмотря на сотни миллиардов долларов, вложенные за последние сорок лет в медицинские исследования, богатые люди живут в среднем лишь на 8 % (пять лет) дольше, чем их бабушки и дедушки, и мы по-прежнему страдаем от тех же хронических заболеваний: рак, болезни сердца, инсульт, болезнь Альцгеймера и функциональная недостаточность органов.

Как заметил один из основателей PayPal Питер Тиль: «Мы хотели получить летающие машины, но вместо них получили 140 символов» [36].


Мечты потускнели

Все вышеописанное посеяло в нас глубокое сомнение: может быть, дни славы человечества действительно остались в прошлом? Может быть, человечеству суждено пережить определенное количество уникальных метаморфоз, и большинство из них мы уже совершили? Раньше мы не умели пользоваться электричеством – теперь умеем. Мы не могли поддерживать санитарно-гигиенические условия жизни – теперь можем. Мы не могли добраться из любого пункта А в любой пункт В – теперь можем. Мы не могли разговаривать в любое время в любом месте – теперь можем. Все, что нам осталось, – беспилотные автомобили и даже квантовая телепортация – меркнет по сравнению с этим.

И возможно, по-настоящему фундаментальные преобразования, которые нам еще предстоят, окажутся намного труднее. Раньше мы просто срывали низко висящий плод. Оглядываясь назад, мы видим, что добиться удвоения продолжительности жизни человека в первый раз было довольно просто: для этого понадобилось лишь удалить из наших домов животных (лошадей, коров, свиней, кур), разделить питьевую воду и сточные воды и обнаружить, а затем наладить массовое производство плесневого материала, убивающего бактерии (пенициллин). Чтобы снова удвоить продолжительность жизни, нам придется приложить намного больше усилий. Для этого мы должны будем разобраться, как происходит старение на генетическом уровне (где оно закодировано) и на клеточном уровне (где выполняется этот код), а затем выяснить, как его затормозить.


Расходы на новые молекулярные разработки, в млрд US$ (с учетом инфляции)

Эпоха открытий

До недавнего времени продуктивность исследования и разработки новых лекарств неуклонно снижалась.

Bart Janssens, Simon Goodall, et al. (2011). Life Sciences R&D: Changing the Innovation Equation in India. Boston: Boston Consulting Group


До недавнего времени руководители крупных фармацевтических компаний наблюдали картину убывающей выгоды каждый раз, когда (хмуро) просматривали расходы на исследования и разработки. Фармацевтическая промышленность инвестирует в исследования и разработки почти 18 % доходов – больше, чем любая другая отрасль за исключением аэрокосмической [37]. За последние двадцать лет, когда фармацевтическая промышленность находилась в поисках следующего большого прорыва, эти расходы резко возросли. В 1990 г. мировая фармацевтическая индустрия потратила на поиски около 25 миллиардов долларов. К 2000 г. расходы удвоились до 50 миллиардов долларов, а к 2010 г. снова выросли более чем в два раза, до 130 миллиардов долларов [38]. Но, несмотря на некоторые громкие успехи – среди них статины, снижающие уровень холестерина, антидепрессанты и лекарства от СПИДа, – результаты исследований не поражают воображение. Число действительно новых препаратов, попадающих в руки общественности, каждый год остается неизменным.

В результате показатели снизились – наблюдается несомненная тенденция к сокращению расходов на исследования новых препаратов. Не было никакого скачка. Не было микеланджеловского момента. Только мучительный, нелегкий путь, с каждым шагом становящийся все труднее.

Более того, дело продвигалось так трудно, что у многих начали опускаться руки. В декабре 2011 г. фармацевтическая компания Novartis закрыла свою нейронаучную лабораторию в Базеле, Швейцария, отказавшись от дальнейшего поиска лекарственных препаратов от болезней мозга. Тем самым она присоединилась к GlaxoSmithKline, AstraZeneca, Pfizer, Merck и Sanofi – все они либо прекратили, либо существенно сократили попытки найти новые лекарства для лечения болезней мозга, поскольку многолетние инвестиции до сих пор не принесли результатов, которые можно было бы продать [39].

Четыре причины поверить

Мы рассказали о приметах индивидуального и коллективного гения, которому предстоит написать историю XXI в. Если взглянуть на все соединяющие и развивающие силы, действующие в наше время, его расцвет кажется самоочевидным. Тем не менее мысль о том, что в настоящее время происходит бурный расцвет гения, вызывает глубокий скептицизм у многих уважаемых людей – включая тех, кто находится в авангарде смелой исследовательской деятельности человечества. Так кто же прав?

Хорошая новость: мы. Не потому что экономисты опираются на неправильные данные, не потому что скептики опираются на неправильные факты, а потому что экономическая статистика и общественные ожидания – плохой критерий для оценки того, какое влияние гений уже оказывает на нашу жизнь.


1. Гений нельзя свести к одной лишь экономике

Гений – и выдающиеся личности, и исключительные коллективные достижения – приносит в наш мир гораздо больше, чем можно подсчитать в рамках экономики.

Скептики, зацикленные на статистике роста, придают много значения данным соцопросов, которые показывают, что более двух третей взрослых в развитых странах мира считают, что следующее поколение будет хуже их [40]. Хотя это многое может рассказать нам о настроениях взрослого населения, есть и более важный вопрос: во что верит само следующее поколение? Согласятся ли они вернуться на 30–50 лет назад и жить в том же мире, что их родители, где им гарантированы трудовая занятость и стабильный рост доходов? Или они предпочтут двигаться вперед, к весьма неопределенному будущему?

Несмотря на недавнее возвращение моды на виниловые пластинки, мы считаем, что подавляющее большинство молодых людей выберет последний вариант. Почему? Потому что кроме стабильных доходов и возможности иметь денежные накопления мы также ценим здоровье. Мы ценим свободу, автономию, участие, связи, влияние. Мы ценим нашу новую близость к самым глубоким тайнам жизни и Вселенной и к нашим кумирам из области спорта и индустрии развлечений. Нам трудно выразить эти ценности в цифрах, но они реальны и важны. Обменяет ли следующее поколение все эти необыкновенные достижения на работу своих родителей?

Если нет, значит, экономисты что-то упускают.

Не все, что имеет значение, можно измерить. Экономисты преуменьшают происходящий в наше время расцвет гения, потому что они сосредоточены только на том, чему могут дать количественную оценку, то есть на экономической активности. Для экономистов прорыв имеет значение, только когда он приводит к появлению новых видов экономической деятельности, – в этом случае его называют «инновацией», влияние которой на нашу жизнь можно, в свою очередь, измерить и проанализировать с экономической точки зрения.

Но гений, согласно нашему определению, представляет собой намного более глубокое явление. Да, гений может порождать инновации (печатный станок Гутенберга и поисковая система Google вызвали к жизни целые новые отрасли), но его роль намного шире – он служит двигателем перемен. В последней главе мы подчеркнули этот аспект роли гения в прикладных науках, но без гения социальный прогресс во всех сферах человеческих чаяний, будь то накопление богатств, здоровье, искусство, стремление к знаниям и справедливости, в конечном итоге остановится, когда мы исчерпаем возможности нынешних способов мышления и деяния. Работа гения – освободить нас из этой темницы, прежде чем она станет для нас слишком тесной.

Когда мы вырываемся из тюрьмы на свободу, новая экономическая деятельность становится одним из многих вариантов возможных последствий. Другие последствия также имеют значение. Например, астрономия в ближайшее время может сделать самое значительное и вместе с тем наименее пригодное для эксплуатации открытие в истории человечества: выяснить, есть ли жизнь на других планетах. Двадцать лет назад повсеместно было распространено мнение, что планеты земного типа редки. Теперь, вооружившись усовершенствованными телескопами, более быстрыми компьютерами и заручившись через интернет помощью десятков тысяч астрономов-любителей, мы понимаем, насколько были неправы. Самая консервативная из нынешних гипотез гласит, что один только Млечный Путь заключает в себе по меньшей мере 10 миллиардов планет, размер, температура и характеристики орбиты которых подходят для развития жизни. Просто добавьте воды. Кстати, воду на Марсе НАСА обнаружило в конце 2015 г. Шансы на то, что инопланетная жизнь где-то существует, хотя бы в микробной форме, выросли с сомнительных до весьма вероятных. В ближайшее время наши планетоходы, закапывающиеся в марсианские ручьи, и телескопы, способные исследовать атмосферы далеких миров, нам это наверняка докажут. В то же время набирает новые обороты поиск разумной инопланетной жизни. В июле 2015 г. русский физик и предприниматель Юрий Мильнер объявил о начале проекта Breakthrough Listen, рассчитанного на десять лет, с бюджетом 100 миллионов долларов. Цель этого проекта – увеличить время сканирования космоса с помощью лучших в мире радиотелескопов с десятков до тысяч часов в год. Как сказал физик Стивен Хокинг на торжественном открытии проекта: «В бесконечной Вселенной должна быть другая жизнь. Нет более важного вопроса. Настало время приступить к поискам ответа» [41]. Этот ответ навсегда изменит наше представление о звездах – и о самих себе. Но он ни на йоту не увеличит показатели продуктивности.


2. Осязаемое воздействие гения не поддается простому измерению

Конечно, экономические условия тоже важны. Даже если мы обнаружим жизнь в далеком космосе, это будет слабым утешением для людей, которые не могут купить себе даже еды, не говоря о телескопе. Некоторые статистические данные рисуют мрачную картину, и это совершенно справедливо. Подсчитать доходы населения довольно просто, и в последнюю четверть века мы наблюдаем быстро увеличивающийся разрыв в материальном положении победителей и проигравших. Это реальная проблема, и она требует реального решения. (Общественное недовольство экономическим неравенством во многом омрачило предыдущий Ренессанс, и в эпоху Нового Ренессанса вполне может произойти нечто подобное. См. главу 7.)

Но если перевести взгляд с личных доходов на общее материальное благополучие общества, картина усложняется. Человек, родившийся в 1970 г., стал свидетелем того, как численность населения Земли увеличилась вдвое, а благосостояние отдельного гражданина возросло на 40 % [42]. Теперь нас в два раза больше, и одновременно мы живем лучше: для любой цивилизации это огромная победа. Почему же статистика не помогает нам это почувствовать?

Дело в том, что при всей важности таких понятий, как валовой внутренний продукт и производительность труда, они не предназначены для выражения совокупного благосостояния общества, а при попытке все же использовать их в этом качестве дают ошибочную картину. Они не в состоянии отразить не только нематериальные выгоды, которые приносит нам расцветающий гений, но даже и многие материальные.


Краткосрочный против долгосрочного

В 1997 г. на собрании акционеров корпорации Intel один из участников потребовал у тогдашнего генерального директора Энди Гроува ответа о недавних обширных тратах компании на интернет-предприятия. Какого возврата на инвестиции они могли ожидать? Гроув ответил: «Как Колумб в Новом Свете. Каким был его возврат на инвестиции?» [43]

Расстояние между достижениями гения и их социально-экономическими последствиями может быть очень большим, особенно когда дело касается новых технологий общего назначения. В развитых странах потребовалось около 75 лет, чтобы экономические преимущества общественной санитарии, электрификации и перехода на ископаемое топливо в полной мере отразились на статистике производительности; в развивающихся странах эти факторы еще не завершили свою работу. Для сравнения, массовое распространение компьютеров произошло менее сорока лет назад, интернета – менее двадцати лет назад. Массовое распространение генетического секвенирования только началось. Квантовые технологии и нанотехнологии буквально вчера вышли из лабораторий. Подсчитывать материальные выгоды, которые последние разработки принесут человечеству, еще слишком рано. Мы знаем только, что эти выгоды будут обширными и значительными.

Как долго придется ждать, зависит, в частности, от отрасли. Например, в физике средний промежуток между крупным открытием и присуждением за него Нобелевской премии составляет 25 лет. Столько времени требуется, чтобы понять, какие новые возможности дает это открытие. В других отраслях дело идет еще медленнее. Теория чисел – по сути, изучение свойств чисел – зародилась еще в Древней Греции и Древней Индии. Новый интерес к ней вспыхнул в эпоху Ренессанса, когда на фоне общего возрождения классического знания греческие математические трактаты были переведены на латынь. Но долгое время теория чисел оставалась неясной дисциплиной. Через две тысячи лет после ее зарождения, уже в XX в., теоретик Леонард Диксон (1874–1954) заметил: «Благодарение Богу, теория чисел не омрачена никакими видами практического применения» [44]. Сегодня этого уже нельзя сказать. Наконец выяснилось, что эта теория имеет практическое применение – вычисление. Без него мы не смогли бы даже понять, не говоря уже о том, чтобы решать, основные проблемы, которые возникают, когда мы пытаемся заставить машину выполнять квадриллион операций в секунду.

Отставание зависит и от характера нового достижения. Мы создаем что-то новое или уничтожаем то, что было раньше? Если мы найдем лекарство от СПИДа, мы сразу будем знать, что с ним делать, и начнем отсчет результатов с того же года. Обнаруженная, разработанная и распространенная в рамках нынешней фармацевтической парадигмы вакцина против СПИДа станет очередным новым препаратом в нашей хорошо укомплектованной аптечке. Сравните это с генной терапией. Она может добавить множество новых препаратов в нашу аптечку, но, кроме того, она намекает, что в один прекрасный день мы, возможно, сможем просто выбросить весь наш мешок лекарств. Зачем впускать в нашу кровеносную систему маленьких химических воинов и терпеть все нежелательные побочные эффекты, которые они с собой приносят, если вместо этого мы можем изменить поведение организма на клеточном – или даже на молекулярном – уровне, чтобы он вернулся к здоровому состоянию? Эта новая медицинская модель будет иметь колоссальные экономические последствия и, возможно, добавит нам еще одно поколение рабочей силы за счет повышения продолжительности жизни, но реализация этих преимуществ займет гораздо больше времени, чем обеспечение каждого пациента вакциной против СПИДа.


Учтенные и неучтенные блага

Измерить долгосрочное воздействие современных достижений трудно. Но даже если мы сузим круг нашего внимания до краткосрочных выигрышей, которые получаем здесь и сейчас, попытка подсчитать выгоды, принесенные гением, вряд ли окажется успешной. Дело в том, что экономическая статистика, такая как показатели ВВП, предназначена для подсчета вещей, которыми обмениваются на определенном рынке по определенной цене, а многие наши непосредственные выгоды не имеют никакой рыночной цены. Они бесплатны.

Экономисты называют эти неучтенные выгоды «положительным излишком». Вместо того чтобы быть должным образом упакованной и проданной на рынке, ценность просто переливается из одной сферы в другую. Металлурги из города Майнц способствовали получению новых сплавов, которые пригодились Гутенбергу для его изобретения, но их «исследования и разработки» не принесли им никакой экономической отдачи после того, как печатный станок подтвердил свою коммерческую успешность. Сегодня одним из способов подсчитать выручку от преимуществ, которые в других случаях остаются бесплатными, являются патенты и лицензионные сборы. С помощью закона мы ограничиваем доступ к идее, что заставляет потенциальных потребителей признать – в долларовом выражении, – какую ценность для них представляет эта идея.

Но патенты покрывают лишь некоторые случаи, в остальном по-прежнему широко распространены переливы положительных излишков. Самые известные и самые наглядные дыры в нашей бухгалтерии связаны с цифровыми товарами. Если будет продан миллион экземпляров Encyclopaedia Britannica, каждый стоимостью 1000 долларов, эти продажи непосредственным образом увеличат ВВП страны на миллиард долларов. Если миллион пользователей получит доступ к Википедии – а Википедия остается бесплатной, – это добавит к ВВП ноль долларов. Даже если база пользователей увеличится с миллиона до миллиарда человек, прибавка снова будет равна нулю [45]. Для всех нас это намного выгоднее – мы получаем вполне осязаемую экономию времени и денег, – но на ВВП это никак не влияет (или даже приводит к его снижению, если в результате будет продано меньше энциклопедий). Аналогичным образом ВВП никак не отражает, насколько мы ценим поиск Google (исследования показывают, что мы экономим в среднем 15 минут на один запрос, или 500 долларов за год) [46] и сколько бесплатного развлекательного и образовательного контента мы потребляем онлайн через друзей и незнакомцев. ВВП не учитывает миллионы часов, которые отдают Zooniverse.org волонтеры, занятые каталогизацией галактик или сигналов китов, – как и любую другую неоплачиваемую работу. Одним словом, макроэкономическая статистика упускает из вида некоторые существенные явления нашей экономики. С эволюцией 3D-печати многие физические товары, которые мы покупаем сегодня, превратятся в цифровые товары, которые мы сможем создавать, публиковать, скачивать и распечатывать в домашних условиях, и гигантская пропасть между выгодами, поддающимися учету, и выгодами, не поддающимися учету, будет по-прежнему расширяться.


3. Гений бросает вызов ожиданиям

Третий пункт – необходимо признать, что наши ожидания не являются незыблемым стандартом, по которому можно судить о достижениях гения. Мы не всегда способны угадать, куда нас перенесет очередной скачок:

Я предсказываю, что интернет… вспыхнет как сверхновая, но в 1996 г. переживет катастрофический коллапс… Наивная тарифная бизнес-модель интернета не в состоянии обеспечить достаточно финансов для обслуживания дальнейшего роста, если рост вообще будет, но его не будет, так что это не проблема.

Роберт Меткалф, один из разработчиков Ethernet и основатель 3Com, в 1995 г. [47]

Еще хуже нам удается угадывать, какими окажутся прорывы будущего. Рефрен «Где летающие автомобили?» – наглядный пример того, как наше мышление попадает в ловушку актуальной парадигмы. В 1950-х и 1960-х гг. все вдруг начали ездить на машинах и летать самолетами. Самый революционный «большой бум», который мы могли себе представить, – что автомобили тоже начнут летать. Гений по определению ломает эти простые линейные экстраполяции из прошлого. То, что сегодня мы все не летаем на машинах – и что большинство из нас сегодня вообще забыли об этой идее, – не провал гения, а скорее свидетельство того, как гений переключает наше внимание и ресурсы в совершенно неожиданных направлениях. Наши машины не летают, но наши идеи перемещаются со скоростью, выходящей так далеко за пределы воображения эпохи 1960-х гг., что даже в метрической системе того времени не было подходящих терминов (префиксы «пета» [1015] и «экса» [1018] появились только в 1975 г.).

Конечно, обычно люди спрашивают «Где летающие автомобили?» не в буквальном, а в переносном смысле. На самом деле они хотят спросить: «Почему гений не решил все наши проблемы?» И в этом заключается вторая ошибка наших ожиданий. Гений не является панацеей.

Мы ждем от него непрерывных технических усовершенствований (меньше, быстрее, дешевле, эффективнее). Мы ждем непрекращающегося роста и прогресса. Мы приравниваем «гений» к «новым технологиям» и ждем, что первое будет изобретать второе, чтобы мы могли ежегодно раздвигать все новые и новые пределы реальности.

Но гений работает не так. Гений никогда не сможет устранить наши проблемы, он может только заменить их новыми. Дело в том, что каждое новое технологическое решение приносит с собой новые потребности, ограничения и непредвиденные последствия. Рассмотрим энергию. Машины, работающие на ископаемом топливе, помогали нам делать больше работы, увеличивать города и быстро перемещаться между ними, но при этом они заставили нас столкнуться с ранее неизвестными последствиями: выбросом в атмосферу углекислых газов. Возобновляемые источники энергии решают проблему выбросов, но создают две другие проблемы, которые ископаемые виды топлива решали довольно аккуратно: хранение энергии (в аккумуляторных батареях, что влечет за собой целый шлейф других проблем) и концентрация энергии для получения взрывного эффекта (например, при движении автомобиля или реактивного самолета). Расщепление ядра атома подарило нам почти неограниченные запасы электричества, но вместе с тем дало оружие массового уничтожения и поставило следующие 40 тысяч поколений людей перед проблемой утилизации ядерных отходов. Если однажды мы откроем ядерный синтез (способ получать энергию так же, как это делает Солнце, сливая друг с другом атомы водорода), можно будет начинать беспокоиться о том, чтобы он не попал в плохие руки. Добиться этого достаточно трудно, когда необработанное сырье (уран и плутоний) редко встречается и с трудом поддается очистке. Но любой школьник может получить чистый водород, опустив девятивольтовую батарейку в стакан соленой воды.

Этот бесконечный обмен одних неудобств на другие происходил всегда и везде [48]. Макиавелли заметил: «Если вглядеться получше, то увидишь, что так бывает во всех делах человеческих: никогда невозможно избавиться от одного неудобства, чтобы вместо него не возникло другое»[23] [49]. В эпоху Возрождения строились корабли, способные выдержать океанское плавание, – они сделали возможными Великие географические открытия, но они же принесли в Америку европейские болезни. Сегодняшние инженеры строят контейнеровозы полкилометра длиной. Эти корабли снижают затраты всемирной торговли, но их балластные воды разрушают целые экосистемы, распространяя инвазивные виды. Около пятисот лет назад военные медики нашли способ сохранять жизнь раненым солдатам с помощью антисептической обработки огнестрельных ран и наложения швов на кровеносные сосуды. Но они не могли избавить пациентов от боли и увечий, на которые таким образом их обрекали. Современная медицина продлевает срок службы человеческого организма, но ничего не может сделать с психической дегенерацией (главным образом с болезнью Альцгеймера) – сегодня все больше людей в мире проживают достаточно долго, чтобы встретиться с этой болезнью. Гидравлические взрывные работы нарушают работу местных водных источников. Усовершенствованная электроника создает общемировую зависимость от редких металлов. Машины синтеза ДНК увеличивают спектр генетически сконструированных биопатогенов.

Гений никогда не сможет решить все наши проблемы.


4. Самые большие подвиги еще впереди

Но гений никогда не перестанет преображать человечество в ответ на проблемы, с которыми мы сталкиваемся.

Мы можем быть уверены, что мрачные прогнозы скептиков, уверяющих, что с точки зрения социально-экономических последствий никакие будущие достижения гения не смогут конкурировать с теми масштабными скачками, которые мы уже сделали, – электрификацией, санитарией и развитием общественного транспорта, – будут опровергнуты.

Утверждения скептиков неверны по двум причинам. Во-первых, как было указано выше, на любом этапе технологического развития мы всегда будем сталкиваться с новыми проблемами соответствующей сложности [50]. Эти проблемы будут подталкивать нас к ответным изменениям, и чем мощнее будут становиться наши технологии, тем более заметными будут эти изменения.

При нашем нынешнем уровне развития одна из самых больших проблем заключается в том, чтобы распространить модернизацию, которой достигли развитые страны, на весь остальной мир – а также передать ее в будущее. Китай последние сорок лет демонстрирует устойчивый высокий рост именно потому, что он активно пользуется наработками, сделанными в развитых странах. Можно надеяться, что в следующие пятьдесят лет Африка и отстающие части Азии, Индии, Латинской Америки и Ближнего Востока последуют за ним. Если мы выйдем из пузыря развитого мира и начнем мыслить глобально, этого подвига уже будет достаточно, чтобы назвать человечество XXI в. лучшим в истории.

Жаль, что пока это невозможно. Инфраструктура добычи ископаемого топлива, на котором держится развитый мир, не соответствует глобальным масштабам XXI в. – и даже нынешним масштабам. (Более подробно об этом см. главу 6.) Если развитый мир хочет сохранить уже достигнутое, а развивающийся мир хочет его догнать, сначала наш гений должен предпринять один из самых смелых шагов и отучить человечество от угля, нефти и газа. Инженерам-энергетикам уже удалось создать ряд потенциальных решений этой проблемы, от повышения КПД двигателей и возобновляемых источников питания, вполне достижимых в ближайшем будущем, до наноразмерных батарей, органических фотоэлементов и микроорганизмов, которые поглощают СО2 и выделяют жидкое топливо.

Во-вторых, мрачные утверждения скептиков основаны на ошибочном применении закона убывающей доходности к человеческому творческому потенциалу. По их мнению, гений – это нечто вроде сосуда, наполненного шарами, каждый из которых представляет новую идею или технологию. Вначале сосуд был полон, но каждый раз, когда мы к нему возвращались, нам приходилось опускать руку за следующим шаром глубже, чем раньше. Однажды сосуд опустеет. Однажды мы полностью исчерпаем наш движущий потенциал [51].

Это впечатляющая метафора, но все обстоит с точностью до наоборот. Гений больше похож на смешивание ингредиентов в лаборатории алхимика. Каждый ингредиент представляет собой уже существующую идею или технологию, и вначале у нас их было всего несколько – немного соли, сахара и простых жидкостей. Но затем мы начали их смешивать, и некоторые вступили в реакцию с другими и образовали новые соединения. Прошло совсем немного времени, и наш лабораторный стол заполнился кислотами, спиртами и порошками. Теперь каждый раз, когда мы заходим в лабораторию, чтобы приготовить что-то новое, мы обнаруживаем более широкий выбор ингредиентов, чем раньше. Нет нужды бояться, что ингредиенты для работы когда-нибудь закончатся. Скорее следует опасаться того, что новые соединения и их возможные комбинации множатся слишком быстро и мы не отыщем в этой груде действительно полезные вещи.

Эта метафора гораздо точнее описывает наш нынешний опыт. Во всех отраслях науки скорость появления новых открытий, как правило, повышается, а не понижается – умножаются внутренние и внешние интеллектуальные контакты между различными дисциплинами, наши компьютеры и инструменты совершенствуются, а мы сами задействуем новые коллективные мощности, чтобы помочь ученым обрабатывать огромное количество возможностей.

Это особенно хорошо заметно в фармацевтической промышленности, где последние достижения в области разработки лекарств опровергли прежние прогнозы о том, что сосуд скоро опустеет [52]. Более глубокое понимание причин болезней, возникшее в результате секвенирования генома, наконец начинает приносить свои плоды. В 2013 г. был поставлен очередной рекорд общего количества новых лекарственных средств, выпущенных во всем мире (48), – и уже в 2014 г. он был превзойден (61) [53].

К недавним громким открытиям в области лекарственных средств относятся: новое оружие против сердечной недостаточности, которая в настоящее время является главной причиной смертности в стареющем мире; иммунотерапия, помогающая победить рак путем повышения собственной иммунной реакции организма; таблетки для борьбы с гепатитом С, более безопасные, быстродействующие и в два раза более эффективные, чем предыдущие инъекционные препараты; и новые методы лечения ВИЧ, которые дольше поддерживают здоровье пациентов и заменяют «коктейль» препаратов всего одной таблеткой в день [54]. Даже болезнь Альцгеймера, с которой уже было отчаялась справиться фармацевтическая промышленность, теперь оставляет шансы на излечение. Первый лекарственный препарат, способный замедлить патологическую утрату памяти, возможно, появится уже через несколько лет [55]. В 2015 г., через тридцать лет упорного труда, компания GlaxoSmithKline объявила, что ее детские вакцины против малярии прошли заключительный этап испытаний. Если они будут одобрены, то смогут ежегодно спасать полмиллиона детских жизней [56].

Открытие каждого нового лекарственного препарата добавляет еще один ингредиент на лабораторный стол алхимика. При этом фармацевтам все еще предстоит проверить квадриллионы возможностей. Лишь 10 % предполагаемых 9 миллионов видов жизни на Земле были каталогизированы [57]. В среднем около 30 % чужеродной ДНК, которую вы носите в своих ноздрях, неизвестны. Но все это изменится. Мы успеем увидеть, как наука запустит легионы роботов в глубины океана, по всей Земле и внутрь наших организмов, чтобы обнаружить жизнь, секвенировать ее и с помощью компьютеров и добровольцев разобраться в найденных чудесах природы. Общее количество искусственных лекарственных молекул, которые теоретически можно сконструировать, очень велико – оно доходит до 1060, в три раза больше, чем звезд во Вселенной [58]. Сегодня современные компьютеры помогают разработчикам лекарств обрабатывать тысячи этих искусственных молекул в поисках полезных соединений. Завтра испытания препарата с помощью компьютерного моделирования позволят обрабатывать их миллионами.

Принесут ли гениальные достижения прибыль в какой-либо конкретной отрасли – по-прежнему открытый вопрос (ответ на который во многом зависит от факторов, никак не зависящих от самих достижений, например от того, какую цену общественность сочтет приемлемой для важного нового препарата). Приведут ли гениальные достижения к экономическому росту по текущим статистическим меркам, предсказать еще труднее. Определенно можно утверждать одно: независимо от того, как далеко мы, как нам кажется, зашли в интеллектуальном и технологическом смысле, впереди нас ждет гораздо больше открытий и превращений, чем осталось позади. Мы стоим у подножия круто уходящей вверх кривой, и нам еще многое предстоит узнать.

Поводы для опасений

Гений ломает ограничения, которые нас связывают. Но возможно, не все цепи предназначены для того, чтобы их рвать. Одни сдерживают нас, другие обеспечивают нашу безопасность. К сожалению, гений не всегда отличает одно от другого. Скептики правы в одном: гений не только совершает открытия, он умножает опасности, которые грозят свести на нет его достижения.


Огнестрельное оружие для всех

…Взрыв пороха, смешанного с селитрой, был таким мощным, и ядра летели по воздуху с такой скоростью… что рядом с этим все прежнее оружие казалось смешным.

Франческо Гвиччардини (1483–1540) [59]

В кровопролитном царстве насилия, творимого людьми, порох преодолел тысячелетние традиции, и вместо человеческой силы, мастерства и скорости главную роль в наших конфликтах стала играть химия.

Изобретенный китайцами в IX в. порох пришел в Европу под звуки канонады – наиболее выразительную партию исполнили большие турецкие бомбарды во время осады Константинополя в 1453 г. Они были «оружием не человеческим, но дьявольским», а полвека спустя, не утратив своей мощи, превратились в более компактное и индивидуальное оружие – аркебузу (ранний мушкет) [60]. В 1503 г. в сражении при Чериньоле 6300 испанцев, вооруженных тысячью аркебуз, победили 9000 французов – это был первый в истории бой, исход которого определило ручное огнестрельное оружие [61]. Потери французов превосходили испанские в соотношении 4:1. Среди убитых был французский генерал, герцог де Немур. Ни сила, ни приобретенное за два десятка лет мастерство фехтовальщика, ни дорогие латы не смогли защитить его от пуль, которые выпускали одетые в кожаные дублеты аркебузиры, научившиеся владеть своим оружием всего несколько дней назад и способные наносить одинаково разрушительные удары, даже если были слабы, измучены или больны.

Пятьсот лет спустя обществу снова приходится иметь дело с опасностью, которая возникает, когда оружие попадает не в те руки. Как и наши предшественники в эпоху предыдущего Ренессанса, мы берем мощнейшие инструменты, некогда доступные лишь единицам, и вкладываем их в руки многих.

Величайшая новая опасность, с которой мы в результате столкнулись, – биотерроризм. При всей своей разрушительной силе огнестрельное оружие имеет свои пределы. Один стрелок может задействовать ограниченное количество боеприпасов, у пули есть предельная дальность полета, и, когда стрелок нейтрализован, угроза перестает существовать. Вирус не страдает от этих ограничений. Даже ядерное оружие имеет конечный радиус распространения взрыва, а биологическое – например оспа – распространяется до тех пор, пока все потенциальные носители не окажутся мертвы либо не выработают иммунитет[24].

Только государства и хорошо финансируемые субгосударственные группы имеют достаточно денег и людей, чтобы производить крупномасштабные разрушения с помощью огнестрельного оружия. На сегодняшний день только государства в состоянии разработать и дислоцировать ядерное оружие. Но оборудование для синтеза ДНК, необходимое для синтеза оспы (или вируса Эбола, или легочной чумы), доступно сегодня во всех странах с высоким уровнем дохода и стоит столько же, сколько тридцать лет назад стоил высококлассный офисный копир, то есть вполне вписывается в бюджет любой хорошо финансируемой негосударственной организации. Это лишь один ингредиент из сложнейшего рецепта, и мнения научного сообщества о том, насколько велика реальная возможность спроектировать настоящий биологический ужас, особенно сделать это тайно, разделились. Риск не равен нулю, и он повышается, а не понижается. Мы можем в ближайшее время вступить в эпоху, когда впервые в истории в руках одного человека окажется власть уничтожить сотни миллионов людей.

История холодной войны показала, что государства, обладающие подобной силой, обращаются с ней серьезно и осмотрительно. И все же тогда они заигрывали с Армагеддоном. История огнестрельного оружия говорит нам, что люди по отдельности заслуживают гораздо меньшего доверия. Возможно, нашей главной защитой против самозваных мессий, стремящихся покарать человечество, станет способность хранить в тайне исходный код смертоносных ошибок природы. Удастся ли нам это? В 2002 г. ученые с нуля синтезировали полиомиелит, использовав геном полиомиелита, опубликованный в журнале Nature еще в 1981 г. [62]. В 2005 г. ученые возродили вирус, ответственный за пандемию испанского гриппа 1918 г., одну из худших в истории [63]. Сколько времени пройдет, прежде чем кто-нибудь создаст еще более смертоносный искусственный вирус? В 2012 г. именно эти опасения вызывали длившиеся полгода всемирные научные дебаты о том, следует ли журналу Science публиковать в статье подробности мутации, позволяющей летальному вирусу птичьего гриппа H5N1 распространиться среди людей. В конце концов редакция журнала все же опубликовала этот материал. Наука, согласно аргументам редакции, делает открытия, которые могут быть использованы и в хороших, и в плохих целях. Поскольку нет никаких гарантий, что никто никогда не захочет использовать эти знания с потенциально катастрофическими последствиями, миру лучше без промедления узнавать о новых открытиях. Это поможет нам заранее принять меры против злоупотребления.

Еще до того, как возникли новые лабораторные технологии ДНК, повысившие уровень этой опасности, мы все несколько раз оказывались на волоске от трагедии. Японская секта «Аум Синрикё», члены которой в 1995 г. распылили в токийском метро отравляющее вещество зарин, также имела в своем распоряжении споры сибирской язвы. Члены секты несколько раз пытались распылить споры сибирской язвы с крыш домов в Токио (после этого они были арестованы). К счастью, штамм, который они использовали, был слишком слабым, а распыление слишком редким, чтобы спровоцировать эпидемию [64]. 18 сентября 2001 г. письма, в которых содержались споры сибирской язвы, были отправлены по почте в несколько американских медиакомпаний и двум американским сенаторам – в результате погибло пять человек и пострадало еще 68. ФБР в конце концов пришло к выводу, что споры были произведены и разосланы одним недовольным ученым из правительственной лаборатории биологической обороны. Если бы этот одинокий ученый произвел и распространил большее количество спор, число погибших оказалось бы во много раз выше[25]. В 2014 г. документы, изъятые у инженера-химика, связанного с Исламским государством, выявили попытку подготовки к использованию в качестве оружия бубонной чумы [65].


Коллективные ошибки

Наши новые коллективные силы также таят в себе опасности – менее масштабные, но более вероятные и всеобъемлющие. В главе 1 мы коснулись того, как те же инфраструктуры, сети и инвестиции, которые связывают и объединяют нас, одновременно облегчают координацию преступности и насилия, разжигают ненависть, позволяют появляться хакерам, мошенникам и террористам-подрывникам и помогают торговле разнообразными незаконными товарами, от наркотиков до поддельных документов для детей, находящихся в рабстве. Электронные книги о получении семтекса (пластическое взрывчатое вещество), видеоуроки по сборке детонаторов из мобильных телефонов, рецепты изготовления метамфетамина, вирусы и пластиковое огнестрельное оружие, распечатанное на 3D-принтере, широко доступны на торговых площадках «глубокого интернета».

Еще страшнее то, что вредоносные идеи, когда-то несущественные или угасающие, теперь могут объединять вокруг себя целые сообщества, достаточно большие, чтобы атаковать наши главные общественные блага (свободу, безопасность, толерантность), и достаточно устойчивые, чтобы сопротивляться попыткам их уничтожить. Негосударственные экстремистские организации – основной на сегодняшний день пример того, сколько зла может принести коллективный гений. Трагедия 9 сентября 2001 г. в США, террористическая атака на железной дороге в Мадриде в марте 2004 г., теракт в лондонском метро 7 июля 2005 г. ярко продемонстрировали, что компетентное, умеренно финансируемое сообщество экстремистов – ответственность за все три атаки взяла на себя Аль-Каида – может нарушить общественную безопасность и спровоцировать гибель и разрушения в местах, имеющих важное стратегическое и символическое значение. Война против Аль-Каиды в Афганистане, а также уничтожение лидера группировки Усамы бен Ладена в 2011 г. сократили ресурсы и престиж Аль-Каиды, но вместе с тем привели к формированию родственных организаций по всей Юго-Западной Азии, на Ближнем Востоке и в Северной Африке. Еще один пример – экстремизм в нашем собственном обществе. Будь то исламские экстремисты, захватившие власть в Ираке и Сирии, или христианские экстремисты, замышляющие насилие в отношении мусульман в США, эти движения опираются на ту же инфраструктуру и технологии, которые помогли сирийским беженцам найти приют в европейских семьях в 2015 г. (подробнее см. главу 7).


Сложные вопросы

Некоторые результаты деятельности индивидуального и коллективного гения не так очевидно плохи, однако они поднимают сложные вопросы о том, в каком мире мы хотим жить.


Мир без рабочих мест

Одним из значимых факторов, способствующих росту производительности, от печатного станка Гутенберга до сегодняшнего дня, была замена множества рабочих несколькими машинами. По мере того как машины прокладывают себе путь в сельском хозяйстве и промышленности, рабочие, потерявшие свои места, перемещаются в сферу услуг – в которой сегодня заняты большинство из нас. Как оказалось, услуги трудно механизировать. Клиенты хотят получить новизну впечатлений, разнообразие, творчество, спонтанность и дружелюбие – все это трудно обеспечить за счет автоматизации. Мы можем автоматизировать сборку двигателя, но нам доподлинно известно, что автоматизировать хорошую стрижку или хорошую книгу намного сложнее.

Благодаря последним достижениям в области искусственного интеллекта и робототехники положение меняется. В 2004 г. появление автопилотируемых автомобилей казалось маловероятным. «Выполнение левого поворота на полосу встречного движения включает в себя так много факторов, что трудно представить себе тот набор правил, который помог бы машине воспроизвести поведение водителя», – утверждали несколько видных экономистов [66]. Шесть лет спустя компания Google объявила о том, что это сделано. Среди других когнитивных задач, которые когда-то считались слишком сложными для автоматизации, но теперь доступны машинам, – выражение сопереживания пациентам с психическими расстройствами; написание рутинных новостных сообщений в газете; выполнение хирургических операций; совершение финансовых сделок; самообучение игре Space Invaders и выигрыш в телевикторине Jeopardy! (суперкомпьютер Watson компании IBM, сделавший это в 2011 г., в настоящее время диагностирует больных раком и предлагает для них схемы лечения).

Почти половина всех нынешних рабочих мест в США находится под угрозой автоматизации в ближайшие два десятилетия – этот нелегкий процесс Клаус Шваб, основатель Всемирного экономического форума, назвал «четвертой промышленной революцией» [67]. Производительность значительно возрастет. Спровоцирует ли автоматизация появление огромного количества хронически нетрудоустроенных людей, которым некуда будет пойти, или для них появятся новые рабочие места? В первом десятилетии XXI в. более правдоподобным выглядел первый сценарий: в 2010 г. лишь 0,5 % рабочей силы США имели работу в новых отраслях, которых еще не существовало в 2000 г. [68]. Что можно сказать о прибыли, которую принесет автоматизация? Разделят ли ее с работниками, чтобы помочь им приспособиться, или пропасть между богатыми и бедными приведет к социальному взрыву? Во втором десятилетии XXI в. это стало реальной проблемой и реальной опасностью, о которой мы подробнее поговорим в главе 7.


Сильные государства

В эпоху Возрождения порох не только сделал сильнее отдельных людей, но и помог укреплению государства. До появления пороха «государство» было весьма расплывчатым понятием: наследственные князья, окруженные небольшой группой придворных и пользующиеся поддержкой союзников из числа знати. После появления пороха военные бюджеты начали расти: прежде всего требовалось создать более надежные укрепления, способные выдержать пушечный огонь, затем построить более мощные пушки, способные разрушить эти укрепления, затем собрать большие армии для защиты и нападения на эти новые бастионы. Следуя той же логике, торговые суда превращались в плавучие крепости. По мере того как военная экономика сбрасывала с доски мелких игроков, «государство» монополизировало применение силы и начало выращивать бюрократическую систему – сборщиков налогов, бухгалтеров, градостроителей, – чтобы идти в ногу с растущими затратами и потребностями «современного» военного дела [69].

Сегодняшние технологии также делают сильнее и отдельных людей, и государство в целом. Коммуникационные технологии позволяют каждому из нас транслировать наше сообщение и одновременно обеспечивают государство новыми ресурсами для контроля той сферы, которую до недавнего времени мы считали своей личной жизнью. В пользу общественной безопасности были сделаны значительные уступки за счет неприкосновенности частной жизни граждан, без согласия общества и даже без его предуведомления. В США Агентство национальной безопасности собирало метаданные (кто, что и когда) о каждом телефонном звонке, сделанном каждым американцем по крайней мере в течение десяти лет [70]. Базы данных зарубежной электронной почты, чатов и текстовых сообщений гораздо обширнее, и право просматривать их имеют более двадцати других правительственных организаций США [71]. Что еще государство держит под наблюдением, мы пока не знаем.

Стоящий ли это компромисс? Есть ли у нас выбор? Наш расцветающий гений заставляет нас без обиняков задать себе эти вопросы.


Эпоха Ренессанса не дает гарантий – она дает возможности, реализовать которые наша общая задача. Скептики правы еще в одном: мы многое могли бы сделать лучше, мы могли бы зажечь в нашем обществе огонь созидания и сотрудничества. «…Нередко случается, – наставлял своих современников Макиавелли, – что от промедления теряешь благоприятный момент»[26] [72]. План энергичных действий см. в части IV.

Тем временем в игру вступают другие силы. Часть III рассказывает о том, что в эпоху предыдущего Ренессанса процветающий гений существовал бок о бок с неожиданными катастрофами и новыми конфликтами, которые люди еще не умели решать. Но среди подобного уродства они продолжали упорно творить красоту и добиваться достижений, которые мы воспеваем до сих пор, пятьсот лет спустя, – это и есть жизненно важное наследие, которое они оставили будущим поколениям.

Мы мчимся вперед сломя голову, и нас ждут похожие бури. Каким окажется наше наследие?

Часть III

Расцветающие опасности

Как нынешнее время создает опасности и порождает общественное напряжение

6

Свирепствует оспа, Венеция тонет

Как время, в которое мы живем, увеличивает системные опасности и мешает их предвидеть

Недостатки общих взаимосвязей

В 1494 г. Лодовико Сфорца, в течение тринадцати лет негласно управлявший Миланским герцогством в качестве регента при малолетнем племяннике, сделал следующий шаг и присвоил себе мантию герцога. Альфонсо II, король Неаполя (который сам претендовал на Милан), оспорил этот шаг и пригрозил свергнуть узурпатора. Но у Сфорцы были союзники. Карл VIII, могущественный король Франции, претендовал на трон Неаполя, и Сфорца убедил Карла, что сейчас самый подходящий момент заявить о своих правах.

Карл собрал армию численностью 25–30 тысяч человек, в том числе 8000 наемников со всей Европы, и отправился в свой итальянский поход [1]. Беспрепятственно пройдя через Милан, его люди огнем и мечом прошлись по остальной части Итальянского полуострова и захватили Неаполь в феврале 1495 г.

Однако Карл просчитался. Демонстрация силы и жестокости принесла ему быструю победу, но вместе с тем она сделала то, чего не смогла бы сделать менее серьезная угроза: заставила государства Италии и их союзников в страхе сплотиться против общего врага. Чтобы изгнать французов из Италии, папа римский созвал Священную лигу – в нее входили Венеция, Испания, Англия, Священная Римская империя (занимавшая крайне приблизительно территорию современной Германии) и даже Милан. (Сфорца начал опасаться, что Карл предаст его и захватит заодно и его собственное княжество.)

6 июля 1495 г. объединенные армии Священной лиги встретили Карла VIII на залитом дождем поле битвы при Форново, чтобы решить судьбу Италии – на данный момент. В пользу Лиги было численное превосходство, в пользу Карла благоприятный рельеф местности. Менее чем за два часа боевых действий французы потеряли тысячу человек, Лига – вдвое больше. Обе стороны объявили о своей победе, ни одна не стала продолжать сражение. Карл отступил назад во Францию и распустил свою армию [2].

Но они оставили кое-что после себя.

Итальянские военные врачи заметили болезнь первыми. Она отличалась от всех недугов, которые они видели и о которых читали раньше, начиная со времен римского императора Марка Аврелия и медицинских трактатов его врача Галена.

Они были хорошо знакомы с чумой – ужасные симптомы и милосердно скорый конец. Больные начинали кашлять кровью и уже через три дня умирали. Но это была какая-то новая, более страшная болезнь. Она чудовищно истощала своих жертв и могла длиться месяцами, даже годами, самым отвратительным образом медленно разъедая живую плоть. Один из врачей писал в своих заметках, что тела страдальцев «покрыты фурункулами размером в желудь, из которых сочится дурно пахнущий темно-зеленый гной» [3]. Первые фурункулы чаще всего появлялись в области половых органов. У тех, кто пережил первые этапы заболевания, появлялись «опухоли размером с лепешку и язвы, постепенно разъедавшие кожу» [4].

Благодаря тому что в обеих армиях было «каждой твари по паре», болезнь стремительно распространялась [5]. Войска, встретившиеся у Форново, вернулись по домам, наемники разъехались. К концу лета таинственная болезнь уже терроризировала города по всей Италии, Франции, Германии и Швейцарии. На следующий год она попала в Голландию и Грецию, еще через год – в Англию и Шотландию. Через четыре года после своего первого появления она распространилась по всей Европе. Еще через пять лет она распространилась по всему миру, не затронув лишь редкие изолированные регионы [6].

С самого начала болезнь принесла Европе намного меньше ущерба, чем «черная смерть». И для остального мира она была определенно менее гибельной, чем другие заболевания, которые переносили европейские моряки, – ее было не сравнить с оспой, опустошившей Северную и Южную Америку. Население приспосабливалось к новой болезни, отвратительные симптомы ослабевали, и постепенно она превратилась в не поддающееся излечению хроническое венерическое заболевание, которое сегодня известно нам как сифилис.

СЛИШКОМ СЛОЖНО ОРГАНИЗОВАНО, ЧТОБЫ РАЗОБРАТЬСЯ, – СЛИШКОМ СКОНЦЕНТРИРОВАНО, ЧТОБЫ СОХРАНЯТЬ БЕЗОПАСНОСТЬ

Часть II показала, как развивающие силы и новые взаимосвязи помогает гению расцветать и в индивидуальной, и в коллективной форме. Теперь мы переходим ко второму следствию работы этих сил: расцветающим опасностям.

Нам всем нужно быть крайне внимательными в отношении этого вида опасностей. Это не те непосредственные опасности, с которыми мы сталкиваемся ежедневно, – такие как риск попасть под машину или стать жертвой ограбления. Об этих опасностях мы все хорошо осведомлены. Нет, это опасности, которых мы не видим, – те, которые приближаются медленно, не привлекая нашего внимания, а затем сваливаются как снег на голову. Многие могут почувствовать на себе этот «дефект бабочки», но мало кто в состоянии его предугадать, поскольку его причины обычно никак не связаны с нашей повседневной жизнью и проблемами. Такие опасности не являются специфическими – они носят системный характер[27].

Системные опасности процветают в наше время, поскольку те же соединяющие и развивающие тенденции, которые пробуждают гений, одновременно обостряют два фактора, способствующие возникновению таких опасностей: сложноорганизованность и концентрацию.


Демоны сложноорганизованности

Многие из нас хорошо осведомлены о возрастающей сложности нынешнего века: мы видим доказательства в нашей собственной жизни. Вернитесь к цифрам и графикам в части I, и вы ясно увидите эту сложно организованную картину в меняющемся рисунке глобальных авиаперелетов, в росте разнообразия и количества международных финансовых потоков, в росте инфраструктуры интернета. Развивающие силы еще больше усложняют ее за счет увеличения объема трафика, проходящего по многочисленным и разнообразным каналам связи, и добавления новых узловых точек, будь то развивающиеся города, университеты, промышленные зоны, порты, электростанции, лаборатории, конференции или журналы.

Мы видели, какие преимущества может принести сложноорганизованность. Она увеличивает количество и разнообразие положительных явлений, с которыми мы можем соприкоснуться, и служит главным катализатором творчества и зарождения новых идей.


Эпоха открытий

Когда сложноорганизованность растет быстрее, чем понимание, появляются слепые пятна


Если говорить об опасностях, то и здесь сложноорганизованность может играть положительную роль. Многообразие контактов и потоков создает позитивные излишки, самым ярким примером которых в современной жизни является интернет. Когда одно звено выходит из строя, его трафик почти мгновенно перенаправляется на альтернативные маршруты, так что конечные пользователи ничего не теряют. Сложноорганизованность создает преимущества.

Но кроме этого она создает проблемы. Чем сложнее становятся наши взаимодействия, тем труднее нам видеть причинно-следственные связи. В нашем восприятии текущих событий появляются «слепые пятна». Можем ли мы принимать правильные решения, когда мы не в состоянии представить себе последствия?

Сложноорганизованность объясняет, почему сифилис так стремительно распространился в эпоху предыдущего Ренессанса и почему его удар оказался таким тяжелым.

Распространение болезней всегда бывает одним из первых незапланированных последствий переселения людей – сифилис стал еще одним ужасающе наглядным примером. В соответствии с широко принятой сегодня теорией о происхождении сифилиса, его появление в Европе всего через три года после того, как Колумб открыл Новый Свет, было не просто совпадением. Скорее всего, его принесли с собой моряки [7]. Новые морские связи между Европой и Америкой подарили коренным американцам смертельный коктейль из европейских болезней – оспу, тиф, корь, грипп, бубонную чуму, холеру, малярию, туберкулез, свинку, желтую лихорадку и др., – но и Евразия, в свою очередь, подверглась воздействию новой тяжелой болезни, против которой у ее жителей не было иммунитета[28]. Скорость распространения этого заболевания по всей Европе и Азии объясняется многообразием новых экономических связей на суше и на море, по которым шли постоянно растущие потоки товаров, людей и домашнего скота.

Неясное происхождение и скорость распространения новой болезни привели людей эпохи Возрождения в растерянность. Состояние медицинских знаний того времени было таково, что причины большинства заболеваний оставались за пределами человеческого понимания, даже если болезнь была хорошо знакома и общество успело выработать против нее более-менее эффективную стратегию. В предыдущем столетии многочисленные повторные вспышки «черной смерти» научили людей распознавать признаки чумы, изолировать жертв и избегать пораженных населенных пунктов до тех пор, пока болезнь не исчезала. Поздние вспышки чумы наносили Европе намного меньше вреда, поскольку процедура была уже отработана. Но сифилис появился внезапно и как будто повсюду одновременно, во всех слоях общества, от крестьянства до духовенства. И он никуда не исчезал. Он продолжал существовать, как и его жертвы, хронической язвой на теле общества, от которой некуда было деться и к которой обществу пришлось так или иначе приспосабливаться.

Отсутствие четкого понимания причин и следствий болезни создало когнитивный разрыв, который общество наполнило стереотипами, суевериями и идеологическими домыслами. Итальянцы называли сифилис французской болезнью, поскольку его, со всей очевидностью, принесли Карл VIII и его солдаты. Французы называли его неаполитанской болезнью, поскольку во Франции он был неизвестен до тех пор, пока солдаты не вернулись домой из итальянского похода. Император Священной Римской империи Максимилиан I видел в этой болезни божественную кару за грехи человека. Чем еще можно было объяснить внезапное и повсеместное распространение совершенно нового недуга, оставлявшего жертв в муках и стыде размышлять о своих проступках? Самое популярное объяснение гласило, что таким образом Бог наказывает людей за грехи плоти. Говоря словами Жана Кальвина (1509–1564), «Бог наслал новые болезни, чтобы пресечь разврат» [8]. Люди придавали большое значение тому, что болезнь поражала в первую очередь половые органы, а в числе первых и самых частых жертв были солдаты и проститутки (две профессии, тесно связанные с сексуальной распущенностью и отсутствием морали). Поговорка «Ночь с Венерой – жизнь с Меркурием» содержала намек на ртутную мазь, ставшую распространенным методом лечения сифилиса.


Дилеммы концентрации

Концентрация является менее очевидным, но не менее дестабилизирующим следствием развития человечества и возникновения сложных взаимосвязей. Развивающие силы обеспечивают концентрацию довольно прямолинейным способом. Мировые достижения в области здравоохранения, благосостояния и образования привели к значительному росту населения, которое предъявляет гораздо больше требований к существующей социальной инфраструктуре, услугам, природным ресурсам и окружающей среде. Подумайте: человечество тысячи лет сжигало ископаемое топливо почти без всяких последствий. Но теперь, когда в мире возник двухмиллионный средний класс и он хочет водить машины, летать самолетами, пользоваться обогревателями и кондиционерами, с коллективным объемом потребления энергии приходится считаться.

Концентрация увеличивает количество и разнообразие наших связей. На первый взгляд это нелогично: если количество каналов, по которым идут товары, услуги, люди и идеи, внезапно увеличивается, не следует ли из этого, что человеческая деятельность должна, наоборот, стать более рассеянной?

И да и нет. Да, многообразие связей открывает больше вариантов для потоков товаров, услуг, людей и идей, но нет, все они перемещаются не в случайном порядке. Они текут туда, где, по нашему мнению, они нужнее всего. Правительства концентрируют общественную инфраструктуру, а предприятия концентрируют свою деятельность там, где считают это наиболее эффективным. Иммигранты и искатели работы сосредоточиваются в тех местах, где больше шансов на трудоустройство и удовлетворительное качество жизни. Промышленность сосредоточивается там, где достаточно талантов, идей и капиталов.

Система связей дает нам выбор. Когда множество людей делает одинаковый выбор, возникает концентрация. Концентрация не только географическая, но и концептуальная, и поведенческая – от унификации процесса подготовки менеджеров по программе МВА до стандартизации культур и методов ведения сельского хозяйства в сегодняшних агропредприятиях и глобального согласования правил, регулирующих банковские и торговые операции.

Подобно сложноорганизованности, концентрация имеет как положительные, так и отрицательные стороны. О первых подробно рассказывается в части II. Концентрация накапливает богатство, идеи, гений и отдельные возможности до критической массы, которая служит катализатором творческих достижений.

Проблемы мы уже обозначили. Концентрация создает дополнительную нагрузку на инфраструктуру, на ресурсы, даже на общительность и доброжелательность, которые помогают нам мирно сосуществовать. Чем выше напряжение, тем больше вероятность срыва. При прочих равных концентрация также означает, что, когда что-то выходит из строя, потери, вероятно, будут выше, а последствия окажутся более серьезными для большего числа людей. Представьте себе две одинаковые солнечные вспышки, способные вывести из строя интернет на всей планете: одну в 1990 г., другую сегодня. Первая всего лишь нарушила бы работу нескольких военных и физических лабораторий. Вторая привела бы к глобальной катастрофе. (И это не просто умозрительные рассуждения. В июле 2012 г. выброс корональной массы Солнца прошел непосредственно через орбиту Земли, разминувшись с нашей планетой всего на одну неделю. По оценкам Национальной академии наук США, если бы столкновение все же состоялось, ущерб, нанесенный электрическим системам Земли, мог превысить 2 триллиона долларов – это в 40 раз больше ущерба, нанесенного ураганом «Катрина», самым «дорогим» ураганом в истории США [9].)

Когда в эпоху предыдущего Ренессанса на людей обрушился сифилис, одной из причин его победоносного распространения стала высокая концентрация населения в городах. Урбанизация спрессовала некогда самодостаточные семьи и деревни в плотные взаимозависимые единицы. В перенаселенных городских постройках складывались идеальные условия для распространения болезней. Комнаты были переполнены, общественной санитарии практически не существовало. Горожане жили бок о бок с лошадьми, свиньями, курами – и их экскрементами. Через города проходило множество путешественников, контакты с новыми и прибывающими издалека людьми были обычным делом. Процветали беспорядочные половые связи [10]. Неблагоприятные природные условия 1490-х гг. – разливы рек, исключительно холодные зимы – дополнительно ослабляли и без того уязвимые человеческие поселения [11].

Сегодня перенаселенные городские постройки по-прежнему представляют собой питательную среду для природных убийц.

Новые болезни

Болезнь всегда была непременным атрибутом человеческого общества. Эпидемии гриппа, по разным оценкам, ежегодно охватывают от 5 до 15 % мирового населения, вызывая серьезные заболевания у 3–5 миллионов человек и смерть от одной четвертой до полумиллиона человек [12].

Однако в последние несколько десятилетий появились новые, быстро распространяющиеся пандемии – вирусы, которые легко передаются от человека к человеку и через короткое время после первоначальной вспышки могут охватить пациентов по всему миру [13]. В XXI в. человечество уже несколько раз сталкивалось с угрозами таких пандемий.


Атипичная пневмония

Первой из новых быстро распространяющихся опасностей стала атипичная пневмония (SARS). Это было первое тяжелое инфекционное заболевание, возникшее в XXI в., и сейчас мы почти забыли о нем, но в 2003 г. атипичная пневмония внезапно привлекла всеобщее внимание и «представляла серьезную угрозу для здоровья и благополучия граждан всего мира, поставила под угрозу функционирование систем здравоохранения, а также государственную стабильность и экономический рост» [14], – писал Карло Урбани, представитель Всемирной организации здравоохранения (ВОЗ), который первым идентифицировал атипичную пневмонию как опасное заболевание (и позднее умер от нее).

Атипичная пневмония, вирусная инфекция с симптомами гриппа, впервые появилась в ноябре 2002 г. в провинции Гуандун в Китае. В настоящее время вирусологи считают, что она передалась людям через летучих мышей либо непосредственно, либо на одном из животноводческих рынков этого перенаселенного уголка Азии. Сам по себе межвидовой скачок вируса был ничем не примечателен и в любой другой момент человеческой истории спровоцировал бы только местную эпидемию. Так думали в провинции Гуандун, когда Лю Цзяньлунь, 64-летний врач, оказавшийся в первых рядах сражавшихся с болезнью, отправился в соседний Гонконг и зарегистрировался в популярном бизнес-отеле. Случайного контакта с носителем инфекции оказалось достаточно. Иностранные гости отеля вместе с Лю заходили в лифт, обедали в столовой и сталкивались с ним в других местах. Улетая домой, в Канаду, Сингапур и Вьетнам, они унесли с собой вирус атипичной пневмонии. Всего за четыре месяца атипичная пневмония распространилась на всех континентах, кроме Антарктиды. Это было самое быстрое размножение вируса в истории человечества.

К счастью, вирус был далеко не самым опасным. К июлю 2003 г., примерно через девять месяцев после его обнаружения, в 30 странах мира было зарегистрировано 8300 случаев атипичной пневмонии (в том числе 775 случаев с летальным исходом). После того как возбудитель был идентифицирован, та же сеть взаимосвязей, которая позволила ему распространиться, обеспечила быструю, глобально скоординированную реакцию под эгидой ВОЗ. Решительные карантинные меры приостановили распространение атипичной пневмонии и не допустили глобальной катастрофы. Отчасти этот успех был достигнут благодаря организационно-плановой работе. Всемирная информационная сеть общественного здравоохранения предупредила ВОЗ о новой вирусной угрозе, когда та еще находилась на предпандемической стадии. Отчасти нам просто повезло. Первые эпицентры пандемии – Гонконг, Торонто, Сингапур – имели полноценную, хорошо развитую систему общественного здравоохранения, способную мобилизоваться и ввести в действие протоколы массового карантина. Если бы атипичная пневмония сначала ударила по менее развитым центрам, например Лагосу или Киншасе, события могли бы принять гораздо более мрачный оборот. Оглядываясь назад, можно сказать, что атипичная пневмония стала «пандемией, которой не произошло» [15].

Тем не менее она нанесла миру значительный ущерб. Хотя она забрала меньше жизней, чем в среднем уносит ежегодный сезон гриппа, смертность была почти на 10 % выше, а многие выжившие получили хронические респираторные осложнения. Паника и карантин в 2003 г. обошлись мировой экономике по меньшей мере в 40 миллиардов долларов. Особенно сильно пострадали туристические отрасли, но кроме них эпидемия повлияла на ряд крупных промышленных зон, в которых рабочие подхватили инфекцию [16]. На данный момент болезнь еще не уничтожена и не найдено ни одной вакцины, которая была бы полностью безопасной для человека [17].


Лихорадка Эбола

Более позднее доказательство нашей растущей уязвимости перед болезнью – вирус Эбола. Если атипичная пневмония стала пандемией, которой не произошло, то лихорадке Эбола это вполне удалось.

В декабре 2013 г. в отдаленной горной деревне в Гвинее, Западная Африка, недалеко от границы Либерии и Сьерра-Леоне, двухлетний мальчик по имени Эмиль вдруг слег с тяжелой болезнью. Она началась с сильной лихорадки, которая через несколько дней сменилась тяжелой диареей и кровавой рвотой. Прошло чуть более недели, и мальчик скончался от потери крови и обезвоживания. Следуя местным обычаям, его семья обмыла тело, а люди, пришедшие на похороны из соседних деревень, обняли его, провожая в последний путь. После этого у некоторых из них появились те же симптомы [18].

Атипичная пневмония вызывает проблемы с дыханием и в некоторых случаях смерть обычно у пожилых людей с ослабленным здоровьем. Вирус Эбола провоцирует обширные внутренние кровоизлияния и убивает от 50 до 90 % здоровых людей, которых поражает. В исследовательских лабораториях ему присваивают самый высокий уровень опасности, уровень биологической безопасности 4, наравне с сибирской язвой и оспой. Во всем мире менее ста лабораторий обеспечивают протоколы для безопасной обработки вируса, меры предосторожности включают в себя систему воздушных шлюзов и душевые кабины, ультрафиолетовое облучение камер, систему обеззараживания воздуха и воды и костюмы биозащиты с независимыми источниками воздуха для персонала.

Вирус Эбола никогда раньше не появлялся в Западной Африке [19]. С момента его открытия в 1976 г. он терзал главным образом сельские регионы Центральной и Восточной Африки (Габон, Уганду, Судан и Демократическую Республику Конго), которые находились на расстоянии 3000–5000 километров от нынешнего эпицентра заболевания. Этот факт плюс радикальное сокращение бюджета ВОЗ на общую сумму около 1 миллиарда долларов в 2010–2011 гг. позволяют объяснить, почему никто не заметил вспышку заболевания, пока она не начала распространяться [20]. К тому времени, как ВОЗ объявила о вспышке лихорадки Эбола в Гвинее в марте 2014 г., вирус уже захватил соседнюю Либерию и Сьерра-Леоне – там погибло 60 человек. В июне 2014 г. было зарегистрировано более 750 случаев заболевания, из них 467 случаев со смертельным исходом – на тот момент это была самая серьезная вспышка лихорадки Эбола в истории [21]. К середине 2015 г., после того как было зарегистрировано 28 тысяч случаев заболевания и более 11 300 смертельных случаев, общее число человеческих жертв в 20 раз превысило все предыдущие вспышки вместе взятые [22]. (При этом не исключено, что реальное количество жертв, в том числе неучтенных, могло быть в два-три раза больше официального.) В то же время экономический ущерб, причиненный этим и без того отчаянно бедным регионам, – согласно подсчетам Всемирного банка, потери составили до 4 миллиардов долларов – в конечном счете погубил едва ли не больше людей, чем сам вирус [23].

Если бы лихорадка Эбола, как ранее атипичная пневмония, разразилась в странах с полноценной системой общественного здравоохранения, ее быстро смогли бы обуздать. При всей его поражающей силе, вирусом Эбола не так легко заразиться, если принять надлежащие меры предосторожности. Больной корью заражает в среднем 18 человек, больной лихорадкой Эбола заражает в среднем менее двух человек, отчасти потому, что болезнь быстро убивает своих носителей, а также потому, что она не распространяется воздушным путем. Для заражения необходим контакт с телом или жидкостями, в том числе передаваемыми через общие поверхности, или при обработке зараженного трупа. Это означает, что пока у общества есть возможность обнаружить и изолировать больных, отследить и поместить в карантин тех, с кем они недавно контактировали, и надлежащим образом подготовить дежурный медицинский персонал, любую вспышку можно оперативно пресечь. (Эффективная борьба с вирусом Эбола в Нигерии показывает, что при наличии воли и ресурсов распространение болезни можно сдержать даже в относительно бедной стране.)

Однако вирус нанес удар там, где системы общественного здравоохранения практически отсутствовали. Три наиболее пострадавших страны – Сьерра-Леоне, Гвинея и Либерия – числятся среди беднейших стран мира, и все они в недавнем времени пережили военные перевороты или гражданские войны. Государственные учреждения Сьерра-Леоне только начали восстанавливаться после затяжной гражданской войны (1991–2002); раны, нанесенные войной в Либерии (1989–2003), были еще глубже, в стране продолжали работать иностранные миротворцы. В Испании, где был зарегистрирован всего один случай лихорадки Эбола (медсестра заразилась от двух пациентов, эвакуированных из Западной Африки), государство выделяет на нужды здравоохранения почти 3000 долларов на душу населения. Сьерра-Леоне тратит 96 долларов, Гвинея – 32 доллара [24]. В Соединенных Штатах, где было также зарегистрировано несколько случаев заболевания среди возвращающихся из Африки добровольцев, на 100 тысяч человек приходится 245 врачей [25]. В Либерии к началу кризиса насчитывалось всего 50 врачей на всю страну с населением 4,3 миллиона человек, причем некоторые врачи умерли на ранних стадиях эпидемии [26]. Низкий уровень образования в отдаленных районах, где возник вирус, еще больше усложнил задачу, стоявшую перед службами общественного здравоохранения. В конечном счете отношение к медикам изменилось, но поначалу население относилось к официальным лицам подозрительно – люди нападали толпой и как минимум в одном случае даже убивали медицинских работников, которые пытались изолировать жертв [27]. Вместе с тем население продолжало придерживаться традиционных врачебных и ритуальных практик – больных и умирающих приносили в церковь, чтобы священники или знахари исцелили их наложением рук. Первым зарегистрированным случаем лихорадки Эбола в Сьерра-Леоне стала местная знахарка, а затем жители деревни, которые обмывали ее тело.

Начиная с первой вспышки, в ходе своего стремительного распространения, а затем обуздания вируса эпидемия лихорадки Эбола в Западной Африке проявила себя как радикально новый вид угрозы общественному здравоохранению. Как вирус Эбола перенесся за 3000 километров от того места, где появился перед этим, пока неизвестно. Возможно, это связано с недавней активизацией торговли между африканскими государствами – с 1995 по 2012 г. ее прирост составлял >10 % в год [28]. Возможно, это связано с массовым исходом беженцев из Демократической Республики Конго (хотя большинство беженцев осели в соседних странах). Возможно, дело в перемене климата, которая изгнала из привычных мест обитания плотоядных летучих мышей – наиболее вероятных носителей вируса в дикой природе. Перенаселенность подталкивает жителей деревень к более тесному контакту друг с другом и с животными, которые обитают в лесах и обеспечивают их мясом.

Как распространялась эпидемия, теперь известно: в первый раз за всю историю вирус Эбола вырвался из деревень и достиг городов, и это произошло в значительной степени благодаря растущим связям между деревней и городом. По этой же причине развитые страны с некоторым опозданием вмешались в ситуацию и направили финансы, медиков и солдат, чтобы остановить продвижение вируса – к 2015 г. на эти цели было потрачено в совокупности 2,9 миллиарда долларов [29]. Солдаты из США и Великобритании строили импровизированные больницы. Мобильные технологии помогали отслеживать недавние передвижения жертв вируса и находить тех, с кем они контактировали. Технологии быстрого секвенирования ДНК были задействованы для получения вирусного генома у сотен пациентов и создания полной картины происхождения и разнообразия штаммов, спровоцировавших вспышку. (Пять ученых, принимавших участие в первых попытках секвенирования в Сьерра-Леоне, скончались [30].) Крупные фармацевтические корпорации и правительственные лаборатории начали ускоренные клинические испытания вакцин на людях.

Эпидемия в отдаленной сельской местности – это трагедия. Смертельный вирус, свободно гуляющий в крупных городах, связанных со всем миром через аэропорты и морские порты, – это глобальная угроза безопасности человечества. «Никогда прежде в истории человечества биопатоген четвертого уровня биологической безопасности не поражал такое количество людей, так быстро, на таком огромном расстоянии и не свирепствовал так долго», – говорится в заявлении ВОЗ от сентября 2014 г. [31]. Если бы вирус распространился в других регионах со слабой системой здравоохранения, а именно в развивающихся регионах Азии (с которыми Западная Африка активно торговала), нас ожидала бы всемирная катастрофа.


Заражение?

Глядя вперед, мы видим на горизонте тревожные очертания еще одной пандемии – вируса H5N1 (птичьего гриппа).

Как и атипичная пневмония, птичий грипп возник в Юго-Восточной Азии, в Гонконге или его окрестностях. Это произошло в 1997 г., когда новый вирус преодолел видовой барьер и перешел от домашней птицы к человеку. Птичий грипп показывает, что не только люди, но и всемирная популяция животных в настоящее время представляет собой один общий патогенный резервуар. Отчасти в этом виноваты мы сами. Хотя зараженные птицы способны мигрировать на большие расстояния, временной промежуток, в который они одновременно мигрируют и представляют угрозу заражения для других птиц, крайне мал; без нашей помощи вирус птичьего гриппа остался бы локальной эпизоотией среди птиц Юго-Восточной Азии [32]. Однако благодаря животноводческой торговле H5N1 в настоящее время является эндемичным для популяций птиц во всем мире. Он убил десятки миллионов птиц и заставил отбраковывать еще сотни миллионов.

Ученые и службы общественного здравоохранения крайне внимательно наблюдают за вирусом H5N1. С 2003 г. зарегистрировано около 600 случаев заболевания людей в 15 странах (как правило, вызванных тесным и длительным контактом с инфицированными птицами) [33]. Исследования показывают, что патогенность вируса птичьего гриппа постепенно увеличивается: он может выживать дольше и инфицировать больше разных видов животных, включая свиней, кошек и собак [34]. Более 60 % зараженных людей погибли – это ставит птичий грипп в один ряд с вирусом Эбола и другими смертоносными патогенами. Но, в отличие от лихорадки Эбола, он легко распространяется (среди птиц), как обычный грипп. Хотя механизм гарантированной передачи вируса от человека к человеку еще не развился, лабораторные исследователи уже выяснили, какие мутации дадут ему такую возможность. Лишь по счастливой случайности природа пока еще не продублировала этот результат.

В тот день, когда мы впервые услышим, что вирус H5N1 передался воздушным путем от человека к человеку, мир остановится. Вы сели бы в самолет, зная, что на одном борту с вами может оказаться остроинфекционный вирус с 60-процентной вероятностью летального исхода? В реальности вы не столкнетесь с таким выбором: протоколы обеспечения безопасности уже будут задействованы – границы закроются, движение воздушного транспорта по всему миру будет прекращено. Пандемические модели показывают, что человеческий вирус H5N1 мог бы с легкостью превзойти «черную смерть» 1348–1350 гг., ставшую причиной самого обширного вымирания людей в истории. По оценкам эпидемиологов, в зависимости от того, как быстро будет обнаружена пандемия и налажено обеспечение вакциной, вспышка H5N1 может поразить до одного миллиарда людей и непосредственно вызвать до 150 миллионов смертей[29]. Паника, беспорядки, грабежи и прочие нарушения общественного порядка могут дополнительно увеличить число погибших. Оставшиеся в живых будут страдать от глобальной экономической депрессии с потерями, исчисляющимися триллионами долларов.


Другие пандемические угрозы

Три пандемические угрозы, о которых шла речь, до сих пор регулярно мелькают на страницах газет, однако они далеко не единственные в своем роде. За последние два десятилетия специалисты-эпидемиологи выявили среди человеческих популяций более 30 новых или возродившихся патогенов, в том числе гепатит С, вирус Зика, холеру, малярию и чуму, а природа каждый день изобретает новые виды [35]. В начале 2013 г. в Китае был обнаружен новый птичий грипп H7N9 – он вызывает серьезные проблемы с дыханием и смертельный исход в трети случаев заражения. В отличие от вируса H5N1 птицы, зараженные H7N9, могут переносить вирус, не проявляя каких-либо внешних признаков болезни, что значительно затрудняет ее обнаружение [36].

Еще одна пандемия, не менее страшная, чем любая из вышеперечисленных, – ВИЧ/СПИД. На сегодняшний день он убил почти 40 миллионов человек – больше, чем все население Канады [37]. Впервые болезнь была обнаружена органами здравоохранения США в 1981 г. – на тот момент от нее страдали около 200 тысяч человек во всем мире. К середине 1980-х гг. это число выросло до 3 миллионов, к 1990 г. до 8 миллионов, к 2000 г. превысило 40 миллионов [38]. Сегодня с этим заболеванием живут 35 миллионов человек; вирус ежегодно убивает более 1,5 миллиона человек и поражает еще 2 миллиона [39]. Но он угрожает человечеству неравномерно. Более двух третей зараженных ВИЧ/СПИДом живут в Африке [40]. В развитых странах мира неустанные профилактические и просветительские усилия служб общественного здравоохранения, а также антиретровирусная терапия помогают сдерживать заболевание. Однако оно по-прежнему свирепствует в тех странах, население которых слишком бедно, чтобы позволить себе нужные лекарства, или слишком медленно осознает, что передающиеся половым путем заболевания требуют пересмотра сексуальных привычек.

С точки зрения распространенности, устойчивости и тяжести последствий ВИЧ/СПИД является настоящей пандемией. То, что он сошел с первых страниц газет в развитых странах мира, говорит нам еще об одном аспекте системной опасности: неравенстве. Ренессансные моменты обнажают существенную разницу в подготовленности людей к потрясениям, которые становятся все более частыми и мощными, и способности справиться с их последствиями. (Подробнее мы поговорим об этом в следующей главе.)


Демоны и дилеммы здравоохранения будущего

До сих пор человечество успешно доказывало, что оно в состоянии совладать с новыми опасностями. Глобальная система борьбы с заболеваниями является одним из самых развитых и эффективных проектов по координации международных усилий. Со времен Второй мировой войны ВОЗ и национальным службам здравоохранения стран – членов ВОЗ в основном удавалось сдерживать пандемические угрозы. Новые, более узкоспециализированные организации, такие как ЮНЭЙДС, доказывают свою эффективность в мобилизации глобального ответа на распространение конкретных заболеваний. Да, теперь заболевания распространяются быстрее и дальше, чем когда-либо, но мы научились быстрее распознавать их и принимать ответные меры.

С другой стороны, проблемы становятся все серьезнее. Их сложность растет. Недавние расчеты показали, что инфекционный патоген, передающийся воздушным путем (например, H5N1), занесенный в любой крупный аэропорт на любом континенте, распространится по всему миру самое позднее через три дня [41]. Если инфицированный человек успеет совершить всего два перелета до того, как будут приняты меры общественного карантина, для предотвращения глобальной пандемии придется вакцинировать более 5 миллиардов человек (75 % человечества). Если он успеет совершить три рейса, потребуется глобальная вакцинация [42].

Концентрационные дилеммы становятся все более острыми. Когда (не «если», а именно «когда») пандемия нанесет удар по крупному политическому, финансовому, промышленному центру и спровоцирует его полную (пусть и временную) изоляцию от всех мировых потоков, это повлечет за собой непредсказуемые последствия для разных отраслей инфраструктуры, в частности энергетики и IT. Но разве крупный бизнес может отказаться от размещения представительства в Лондоне, Нью-Йорке или дельте Жемчужной реки в Китае?

Почти универсальное применение антибиотиков и противомикробных препаратов среди формирующегося всемирного среднего класса, повсюду, от больниц до животноводческих ферм, ускоряет развитие в природе устойчивых суперинфекций. А наши растущие связи распространяют их по всему миру. Одна из таких суперинфекций, метициллинрезистентный золотистый стафилококк, уже стала неизбежной неприятностью (а иногда и серьезной угрозой) в больницах и домах престарелых по всему миру. Другая, разновидность кишечной палочки, обнаруженная на свинофермах в Китае в ноябре 2015 г., обладает устойчивостью к колистину – мощному антибиотику, который свиноводы смешивают с кормом, чтобы поддерживать здоровье скота, и который является для человечества «последним прибежищем» на случай, когда все остальные известные антибиотики окажутся неэффективными. Если подобную устойчивость разовьют другие бактерии, некогда простые инфекции могут стать неизлечимыми [43]. В интересах общей безопасности и здоровья нам следует резко сократить использование антибиотиков (особенно у животных) до тех пор, пока не будет разработана замена. Но кто может позволить себе оставаться незащищенным?

В развивающихся странах благодаря притоку мигрантов и снижению детской смертности города стремительно растут. Города предлагают лучшие рабочие места, образование, здравоохранение и другие услуги и больше возможностей по сравнению с сельской местностью. Кроме того, они переполнены и грязны. Люди и животные существуют в них бок о бок, система водоснабжения устаревает и легко поддается загрязнению. В таких условиях возникли эпицентры атипичной пневмонии и птичьего гриппа, и они породят немало пандемических угроз в будущем. Эти новые патогены будут угрожать всем нам, и бедные города будут наименее подготовлены к тому, чтобы противостоять им. Но где бы мы ни родились, среди сельской бедноты, в городской фавеле или трущобах или в стране с передовой экономикой, ищущей новые возможности роста, разве мы можем отрицать привлекательность городов?


Мы выдержали немало испытаний и по большей части вышли из них победителями. Но нет никаких сомнений в том, что возбудители болезней будут продолжать неустанно атаковать наши все более многолюдные и проникнутые взаимосвязями поселения и стремиться обратить нашу глобальную торговую и транспортную инфраструктуру против нас. Природа никогда не сдается.

Торговцы погибелью

Кризис тогда

В части I мы говорили о том, как изменилась финансовая система в эпоху Возрождения. Новые континентальные и межконтинентальные торговые связи, а также переживающие экономический расцвет береговые районы перетянули центр финансовой деятельности из Средиземноморья в Атлантику. Создавались новые финансовые инструменты и рынки для обеспечения капитала и страхования все более сложных и дорогостоящих торговых предприятий. Долговые расписки были либерализованы и уже не ограничивались двумя подписавшими их сторонами. Теперь их могли свободно покупать и продавать третьи лица на вторичных рынках. Это нововведение породило континентальный денежный рынок, в стоимостном выражении в сотни раз превосходящий рынок материальных товаров, который он финансировал. Зарекомендовавшие себя купеческие дома могли писать расписки для фондовой биржи, опираясь на одну лишь силу своего имени, даже если документ не был обеспечен никакими товарами. Пожалуй, они даже могли бы выпускать собственные деньги.

Этот денежный котел, обещающий легкую наживу, непреодолимо манил к себе королей и правителей – они одалживали у купеческих домов огромные суммы, чтобы финансировать свои войны и честолюбивые стремления. Одним из самых известных в то время был случай, когда Карл I, король Испании, в 1519 г. взял в долг около 850 тысяч золотых флоринов у купеческого дома Фуггеров из Аугсбурга, чтобы подкупить курфюрстов и стать императором Священной Римской империи [44].

Сегодня мы все хорошо представляем, к чему приводят такие ситуации. Будь у нас возможность, мы вернулись бы на пятьсот лет в прошлое и предупредили ренессансных инвесторов о том, что произойдет дальше. К сожалению, им пришлось уяснить это на собственном опыте. Фуггеры в XVI в. весьма охотно одалживали (под очень высокие проценты) европейским правителям крупные суммы, которые извлекали из фондовой биржи, и не принимали во внимание того, что даже государь может не выполнить свои денежные обязательства. Карл I получил вожделенный трон, но отказался выплачивать долг. Фуггеры, а вместе с ними великое множество мелких инвесторов по всей Европе, покупавших расписки Фуггеров, понесли тяжелые потери.


Кризис сейчас

Мы тоже выучили этот урок трудным путем во время финансового кризиса 2007–2008 гг. и последовавшего за ним длительного периода рецессии. В ретроспективных анализах не раз писали: американские и европейские банкиры раунд за раундом вели высокоприбыльную игру, заключавшуюся в кредитовании наличными потребителей и покупателей жилой недвижимости, удалении долгов и рисков из своих бухгалтерских книг посредством секьюритизации и кредитных деривативов и выдаче новых кредитов – пока домохозяйства не потонули в ссудных процентах, а балансовые сводки крупных финансовых учреждений не наводнили сотни миллиардов безнадежных задолженностей, которые никогда не будут выплачены. Интеграция стран с развивающейся экономикой в глобальные рынки капитала усилила риск: Китай производил много наличных денег и после азиатского финансового кризиса 1997 г. видел мало инвестиционных возможностей в Азии, поэтому он обрушил их на экономику США, выкупив государственный долг страны. Иностранные денежные вливания помогли смягчить внутренние процентные ставки и позволили продолжать игру немного дольше.

Мы не понимали, насколько хрупкой стала в результате этих действий мировая финансовая система, и мы ее сломали. Домохозяйства, взявшие большие ипотечные кредиты и убежденные, что цены на жилье никогда не опустятся, оказались неправы. Специалисты по количественному анализу, считавшие, что им удалось достаточно ловко упаковать ненадежные долги, снизить риски и обеспечить их выплату, оказались неправы. «Страховки» (кредитные деривативы), которую фирмы приобрели для хеджирования против невыплаты, оказалось недостаточно. Негативные последствия оказались колоссальными. К 2009 г. финансовый кризис принес всемирному рынку 4,1 триллиона долларов убытков [45]. Примерно 50 миллионов человек по всему миру потеряли работу, из тех, кто сумел сохранить занятость, четверть миллиарда перешли в категорию «работающей бедноты» [46]. В Африке, согласно разным оценкам, умерло от 30 до 50 тысяч детей – от голода, который стал прямым следствием наступившего за кризисом глобального экономического спада [47].

На данный момент эту историю пересказывали столько раз – в интервью, журнальных статьях, книгах, голливудских документальных и художественных фильмах, – что ее основные уроки теряются среди взаимных обвинений. Но если рассматривать ее через объектив Ренессанса, ключевые выводы вновь становятся очевидными [48].


Сложноорганизованность ослабляет нашу дальновидность

Первый урок говорит о том, как растущая сложноорганизованность мешает четкому пониманию рисков в финансовой сфере. Столкновение соединяющих и развивающих сил породило глобальную финансовую систему, которая неожиданно оказалась гораздо больше и сложнее, чем два десятилетия назад, и это, с одной стороны, не позволило нам вовремя разглядеть опасность, а с другой – помогло опасности распространиться намного шире и затронуть всех и каждого.

Оглядываясь назад, мы понимаем, что опасности, связанные со сложноорганизованностью, были очевидны. На системном уровне балансовые ведомости всех стран мира, учреждений и отдельных инвесторов стали более плотными и взаимосвязанными (см. часть I). На уровне продукта финансовые инструменты стали сложнее, во многом благодаря тому, что к процессу сбора кредитного портфолио подключились более мощные компьютеры. Крупнейшим инвестиционным организациям, таким как пенсионные фонды, было запрещено инвестировать средства в ипотечные и иные потребительские кредиты. Пенсионные фонды, которым доверяли пенсионные накопления целых отраслей промышленности, могли инвестировать только в активы, которые признали безопасными основные кредитные рейтинговые агентства (Standard & Poor’s, Moody’s & Fitch), а потребительские кредиты были слишком мелкими и рискованными, чтобы привлечь внимание агентств. Но что, если сложные компьютерные алгоритмы смогут соединить в единое целое тысячи индивидуальных ипотечных и потребительских кредитов, более или менее безнадежных, и сделать так, чтобы каждый полученный таким образом массив соответствовал нужным параметрам по размеру и качеству? Именно это, по сути, сделали ипотечные кредиторы: этот процесс называется секьюритизацией [49]. Подвергнув ипотечные кредиты секьюритизации и немедленно продав их инвестиционным организациям, вместо того чтобы продолжать держать эти кредиты и связанные с ними риски невыплаты в своей отчетности, ипотечные кредиторы лишились стимула для тщательного изучения кредитоспособности потенциальных домовладельцев. Качество ипотечного кредита снижалось, но ни рейтинговые агентства, ни учреждения, которые приобретали эти сложные продукты, не имели аналитического потенциала или мотивации, чтобы докопаться до истины. Некоторые фонды решили уберечься от невыплаты, купив страховку (так называемые кредитные дефолтные свопы, CDS), но эта практика только распространила опасность в новые области. Страхователи не имели представления о лежащем в основе ипотечном риске, а пенсионные фонды имели еще меньше представления о (не)платежеспособности страховых компаний, чьи свопы они купили[30]. Подобно пандемическому патогену, токсические долги, возникнув в небольшой заводи (высокорискового ипотечного кредитования), быстро распространились через взаимосвязанные бухгалтерские системы и поставили под угрозу всю финансовую отрасль в целом [50].

Распространявшаяся сверху вниз и снизу вверх финансовая путаница ослепила тех, кто стоял в центре всех этих процессов. Ни в частном, ни в государственном секторе не разглядели постепенно надвигающуюся опасность. Как заметил в 2008 г. обозреватель компании Bloomberg, «[генеральный директор Bear Stearns] играет в бридж, а [генеральный директор Merrill Lynch] играет в гольф, пока их фирмы терпят крах, – и не потому что им плевать на собственные фирмы, а потому что они не знают, что их фирмы гибнут» [51]. В своем Докладе по вопросам глобальной финансовой стабильности в 2007 г. МВФ пришел к выводу, что «слабость определенных участков субстандартного рынка, по всей вероятности, не представляет серьезного системного риска. Стресс-тесты, проведенные инвестиционными банками, показывают, что… большинство инвесторов, имеющих дело с высокорисковыми ипотечными кредитами посредством секьюритизированных структур, не будут нести убытки» [52].

Их концепция риска была линейной: она заканчивалась на полях их собственного бухгалтерского баланса, и они либо не видели, либо не принимали всерьез более широкую картину, которая возникала, когда бухгалтерские балансы всех компаний были выложены рядом, бок о бок.


Концентрация ослабляет нашу устойчивость

Второй урок говорит о том, как рост концентрации повышает вероятность сбоев в работе финансовой системы. В преддверии финансового кризиса концентрация увеличивалась на всех уровнях.

На уровне фирмы капитал и ресурсы сосредоточились в новых секьюритизированных ипотечных и долговых продуктах. На рубеже XXI в. эти продукты были нишевыми предложениями, к началу кризиса они превратились во второй по величине класс ежегодно продаваемых в США обеспеченных активами ценных бумаг. Первым по величине был класс высокорисковых ипотечных кредитов [53].

Финансовая отрасль в целом также переживала подъем концентрации. В Соединенных Штатах в период с 1990 по 2008 г. рыночная доля трех крупнейших банков выросла в четыре раза, с 10 до 40 %. В Великобритании в 2008 г. трем ведущим банкам принадлежало 80 % рынка (в 1997 г. этот показатель был равен 50 %) [54]. Когда речь заходила об этих исполинах, нередко звучала фраза «слишком большие, чтобы обанкротиться». Их руководители были уверены, что правительство не позволит им разориться, – это вызвало бы настоящий хаос. Их инвестиционная дисциплина ослабла – экономисты справедливо называли это явление «моральным риском». Крупнейшие финансовые учреждения стали брать на себя чрезмерные риски, уверенные, что, если дела будут совсем плохи, налогоплательщики их выручат. Что ж, мы действительно это сделали.

Кроме того, концентрация выросла на уровне целых стран – растущий финансовый сектор занимал все больше места в общей экономической структуре государства. В Великобритании в период между 1990 г. и началом кризиса финансовый сектор вырос с <6 почти до 10 % от общего объема ВВП [55]. Еще более опасная ситуация сложилась в Исландии. На заре нового тысячелетия Исландия с населением чуть более 300 тысяч человек была небольшим государством, основу экономики которого составляло рыболовство. К 2008 г., после того как радикальное дерегулирование крошечной финансовой отрасли острова превратило Исландию в убежище для европейских инвестиций, банки Исландии накопили 75 миллиардов долларов долгов – по четверти миллиона на каждого мужчину, женщину и ребенка в стране. Когда разразился финансовый кризис, исландская крона обвалилась, и некогда простая, но стабильная экономика была парализована резко возросшей стоимостью иностранного долга. Учитывая размеры экономики страны, этот случай был и остается самым крупным крахом банковской системы в истории [56]. Уровень безработицы вырос с нуля до 10 %, пенсии просто исчезли. Международный валютный фонд предоставил Исландии финансовую помощь при условии, что исландцы будут выплачивать инвесторам из Великобритании и Дании в целом 6 % от общего исландского ВВП ежегодно с 2017 до 2023 г. Финансовый сектор Исландии настолько разросся по отношению к реальной экономике, что, когда он рухнул, вслед за ним рухнула вся страна.

Исландия также привлекла внимание к возрастающей концентрации в нормативной сфере – во многих странах мира была принята общая политика дерегулирования в отношении внутреннего финансового сектора; в 2009 г. исполнительный директор по финансовой стабильности Банка Англии Энди Холдейн назвал это состояние «монокультурой», которая «подобно растениям, животным и океанам, стала менее устойчивой к болезням» [57].

Каждый из этих случаев концентрации представляет настоящую дилемму. В каждом из них мы должны были найти компромисс между разумными частными целями и малоизученными общественными опасностями. Но какой политик мог позволить себе пойти против тенденции дерегулирования, когда капитал казался таким мобильным и ослабление кредитных условий так нравилось избирателям? Какая финансовая фирма могла позволить себе оставаться в стороне от нового рынка, когда у тех, кто выходил на него, прибыли так стремительно росли? Какой человек не соблазнился бы перспективой получить жилье за небольшие деньги или вообще бесплатно и обеспечить эквити, просто наблюдая за тем, как растет стоимость недвижимости? Все это приводит нас к следующему вопросу: кто же тогда виноват?

Финансовый кризис показал, насколько сложными могут быть эти дилеммы. Даже если бы мы лучше понимали, насколько реальна опасность краха, неясно, что мы стали бы делать, чтобы его предотвратить.

Выучили ли мы наш урок? Или же история повторится в очередной раз?

Не принимайте ничего как должное

Инфраструктура имеет жизненно важное значение. В буквальном смысле это структура, которая лежит в основе (инфра) современной жизни – фундамент, на котором мы возводим наши экономические системы, корпорации, города, семьи и индивидуальные жизненные планы. Инфраструктура включает в себя транспортные сети, по которым двигается сырье, товары и услуги, люди и идеи; системы, которые поставляют населению энергию, пищу и воду; каналы связи, по которым передается все, от удаленного мониторинга электросетей до наших подборок в Pinterest, и многое другое.

Эта инфраструктура находится под угрозой, что само по себе не ново. Во всем мире лишь счастливое меньшинство пользуется общественными системами, которые полностью соответствуют предъявляемым к ним требованиям. Большинство жителей Земли, однако, гораздо лучше знакомы с неполноценной инфраструктурой, не столько облегчающей, сколько осложняющей их повседневную жизнь. Те же соединяющие и развивающие силы, которые увеличивают здоровье, богатство и численность населения, предъявляют новые требования к отсталой и устаревающей инфраструктуре. Последствия финансового кризиса лишь усугубляют напряжение, которое острее всего чувствуется в самых важных областях современной жизни: энергоснабжении, водоснабжении и питании.

По оценкам Всемирного экономического форума, сумма необходимых общих инвестиций в инфраструктуру в течение следующих двадцати лет составит во всем мире 100 триллионов долларов [58]. Эта проблема существует даже в богатых странах. Американское Общество инженеров гражданского строительства присвоило современной инфраструктуре США общий класс D+. Железные дороги и мосты в стране находятся в «посредственном» состоянии, дороги, системы водоснабжения и канализации – в «скверном», дамбы и судоходные пути от «ниже среднего» до «непригодного к использованию». Чтобы обеспечить американской инфраструктуре «хороший ремонт», до 2020 г. потребуется 3,6 триллиона государственных денег. Запланированные вложения (2 триллиона долларов до 2020 г.), возможно, замедлят деградацию городов США, но не помогут им использовать новые возможности процветания [59].

Еще острее эта проблема стоит в бедных странах. Чтобы удовлетворить быстро растущие потребности, к 2020 г. развивающиеся страны должны будут удвоить те совокупные 800–900 миллиардов долларов, которые они в настоящее время ежегодно тратят на инфраструктуру [60]. Например, Индия страдает от регулярной и все более острой нехватки электроэнергии. В городских центрах электричество отключается в среднем на 17 часов в день в сезон муссонных дождей и на три часа в день все остальное время, – при этом около 40 % сельского населения вообще не имеют доступа к электричеству. В июле 2012 г. произошло крупнейшее отключение электричества в истории Индии – более 600 миллионов человек (9 % населения планеты) оставались без света более двух дней.

Такие кризисы, несомненно, приносят много вреда, но в них нет ничего непонятного. Ответных мер не всегда бывает достаточно, но, по крайней мере, мы знаем, что делать: только в 2014 г. было учреждено полдюжины новых многозадачных фондов и служб для поддержания объектов инфраструктуры. Однако сегодня инфраструктуре дополнительно угрожают сложноорганизованность и концентрация, которые подрывают другие социальные системы, и здесь как раз много непонятного. Как все угрозы, затрагивающие основные социальные системы, они чреваты серьезными последствиями. Но, в отличие от традиционных опасностей, связанных с инфраструктурой, мы не имеем четкого представления о том, как на них реагировать, – финансовая обеспеченность и техническая продвинутость здесь не дают защиты. Богатые и бедные в этом вопросе одинаково уязвимы.


Венеция тонет

Этот урок Венеция выучила в эпоху предыдущего Ренессанса. Начиная с XI в. Венеция была самой богатой и самой успешной державой Западной Европы; к 1500 г. ее граждане были самыми богатыми в мире и имели самый большой в мире доход на душу населения [61]. Остальные страны на континенте развивали базовые отрасли промышленности – лесозаготовки, разведение крупного рогатого скота и выращивание зерна, добычу полезных ископаемых, – но венецианская экономика отличалась поразительной продвинутостью: в ней преобладали торговля и сопутствующие услуги. Это был, по сути, «офшорный таможенный склад» (в чем-то похожий на современный Сингапур) – его основными ресурсами было географическое положение и большое количество искусных продавцов, знавших толк в спросе и предложении, во вкусах покупателей и сроках доставки, а также понимавших, как много значит благоприятная налоговая, правовая и валютная среда [62]. Благодаря сильному торговому флоту Венеция была главной морской державой мира, установила безоговорочную монополию на средиземноморскую торговлю и стала первым европейским государством, вступившим в серьезный и длительный контакт с исламским миром.

Хотя в Венеции существовало собственное производство стеклянной посуды, шелка, бумаги и других изысканных товаров, основным источником ее богатства была торговля пряностями, которые она импортировала в Европу через сотни посредников в населенных пунктах, расположенных вдоль Великого шелкового пути, и через Индийский океан. Сегодня перец является будничной приправой, которую мы по вкусу добавляем в пищу. Но в эпоху, когда не существовало холодильников, перец, шафран и другие специи определяли разницу между пригодным и не вполне пригодным для еды мясом. Континент развивался, и спрос на пряности рос, пропорционально росла прибыль венецианских торговцев и значение средиземноморской транспортной инфраструктуры в экономике этого города-государства. Два крупных внешних потрясения доказали, что именно эта инфраструктура является самой большой слабостью Венецианской республики.


Эпоха открытий

Богатство Венеции зависело от самой длинной в мире цепи поставок

Greg Prickman (2008). “The Atlas of Early Printing: Trade Routes.” Библиотека Университета Айовы. По материалам atlas.lib.uiowa.edu плюс аналитика авторов


Первым потрясением стал приход в Средиземноморье Османской империи. В 1453 г. турки захватили Константинополь, в течение многих столетий служивший неприступным оплотом, защищавшим Европу от исламской экспансии. За осадой Константинополя последовала серия военно-морских сражений в Средиземном море, кульминацией которых в 1499 г. стала битва при Зонкьо. Это был самый большой морской бой в истории того времени, в нем участвовало более 350 судов и 55 тысяч человек, и поражение Венеции в этом сражении ознаменовало окончательный переход восточной части Средиземного моря в руки турок.

С точки зрения османов, эти события продемонстрировали положительное влияние новых связей и экономического развития на ресурсы и благосостояние их собственной империи. Чтобы атаковать стены Константинополя, османы соединили китайский порох с венгерскими пушками. Они овладели европейскими военно-морскими технологиями, чтобы построить галеры – большие, быстрые и впервые оснащенные пушками, – и вырвали контроль над Средиземноморьем у самого опытного военно-морского флота в мире. Они адаптировали, а не разрушили венецианские торговые каналы и представительства, чтобы финансировать строительство собственной империи. После каждой войны они приступали к переговорам, которые вновь открывали торговлю и обмен между Востоком и Западом (разумеется, уже по новым ценам).

Итак, с турками можно было вести переговоры, – но география была неумолима. Второе потрясение, постигшее Венецию, в долгосрочной перспективе оказалось более разрушительным. В 1499 г. в городе распространился тревожный слух: на индийских рынках пряностей были замечены три португальских корабля. Васко да Гама отыскал свой морской путь в Индию. «Услышав эту весть, весь город… потрясенно замер, и мудрейшие сочли, что это худшая из когда-либо слышанных новостей», – писал венецианский сенатор и банкир Джироламо Приули [63]. Венецианские купцы мгновенно поняли, что это значит: Португалия будет покупать пряности оптом и доставлять на кораблях прямым путем, минуя непомерно высокие пошлины и сотни мелких посредников, пригревшихся вдоль сухопутного маршрута, за семь веков проложенного Венецией. Одним мастерским ударом конкурент сделал бесполезной всю венецианскую инфраструктуру средиземноморской торговли пряностями.

Последствия не заставили себя ждать. В следующем году цены в Венеции резко упали – Атлантическое побережье сулило гораздо более выгодные условия торговли. Многие немецкие покупатели пряностей перенесли свой бизнес в Лиссабон. В конечном итоге сворачивание сухопутной торговли пряностями оказалось все же не таким драматичным, как казалось поначалу, поскольку у морского пути были свои недостатки: бури, пираты и враждебное население прибрежных районов Восточной и Западной Африки. Тем не менее оно было неизбежным. Города сухопутных торговых путей, процветавшие с древних времен центры торговли и культуры – Багдад, Бейрут, Каир, Дамаск, поселения Черного и Красного морей – сдали позиции и постепенно пришли в упадок. Сама Венеция не столько пришла в упадок, сколько начала заметно отставать. Ее правители и купцы долго и мужественно боролись, по очереди пробуя обратиться то к судостроению, то к производству тканей или сельскому хозяйству, но их город-государство был слишком невыгодно расположен, чтобы конкурировать с зарождающимися морскими империями.

Венецианцы, как и многие другие, считали, что их долгий расцвет будет продолжаться вечно. Они не смогли разглядеть приближение разрушительных нелинейных потрясений – подъем Османской империи и открытие более выгодных торговых путей, – от которых их не смогли защитить собственные торговые успехи. Венеция не была подготовлена к этим потрясениям, и вместе с ней рухнула некогда процветающая межконтинентальная торговая сеть.


Наводнение в Таиланде

В современных цепях поставок и инфраструктуре наблюдается похожая картина. Накопленная концентрация оставляет нас беспомощными перед внезапными, не поддающимися предвидению потрясениями. Мы интуитивно предполагали, что «глобализация» принесет с собой всевозможные новые опасности, но в действительности мы все независимо друг от друга пришли к сходным выводам о том, как и где минимизировать затраты, повысить эффективность или достичь других одинаковых для всех целей, – и наши инвестиции и действия, наоборот, стали более однообразными [64]. Только недавно мы начали понимать, каким образом наше общее стремление к одинаковым результатам увеличило нашу коллективную беззащитность перед потрясениями.

Как продемонстрировали пятьсот лет назад венецианцы, цепочки поставок особенно подвержены накапливанию концентрации. Прибыльные перспективы заставляют частный бизнес быстро двигаться. В 1990 г. в Таиланде существовала довольно скромная электронная и автомобильная промышленность [65]. В 1995 г. Таиланд вступил в ВТО, и к 2010 г. на долю этих производств приходилось 35 % тайского ВВП и 20 % рабочих мест в стране [66]. Более 40 % всемирных заказов по сборке компьютерных жестких дисков и немалая доля производства запчастей для японских автомобилей переместились в окрестности Бангкока [67]. Почему? Потому что там была дешевая рабочая сила, льготная государственная политика и доступ к близлежащим азиатским торговым центрам. Чем больше предприятий следовали этой логике, тем соблазнительнее она казалась другим предприятиям, и именно поэтому, когда сильнейшие тропические ливни в конце 2011 г. затопили Бангкок и соседние области, разрушительные последствия ощутил на себе не только Таиланд, но и весь мир.

Прямой ущерб от наводнения составил 40 миллиардов долларов, более 2 миллионов человек временно остались без работы [68]. Косвенный ущерб заключался в том, что прекращение экспорта автозапчастей вынудило компании Nissan и Toyota приостановить или отменить производство в Малайзии, Вьетнаме, Пакистане, на Филиппинах, в Соединенных Штатах и Канаде [69]. Потери в электронной промышленности спровоцировали взлет цен на электронную продукцию во всем мире и нанесли тяжелый удар по акциям технологических компаний в фондовом индексе Nikkei в Японии и на фондовой бирже NASDAQ в Нью-Йорке. После того как половина мирового производства компьютерных жестких дисков ушла под воду, выпуск персональных компьютеров во всем мире застопорился. На другом берегу Тихого океана, в Санта-Кларе, штат Калифорния, компания Intel в четвертом квартале 2011 г. потеряла 1 миллиард долларов дохода [70]. Производство жестких дисков в Таиланде возобновилось, но ненадолго. Наводнение 2011 г. ускорило переход высокотехнологичной индустрии на твердотельные диски, которые производили соседи Таиланда, и с 2013 г. экспорт тайских жестких дисков начал неуклонно сокращаться [71].

Похожая история случилась весной 2010 г., когда в Исландии проснулся вулкан Эйяфьядлайёкюдль. Облако пепла, повисшее над Западной Европой, привело к шестидневной остановке работы трех главных аэропортов, соединявших Европу с остальным миром, – лондонского Хитроу, аэропорта Франкфурта и аэропорта Шарль-де-Голль в Париже. Было отменено почти 100 тысяч рейсов, и последовавший за этим хаос – от отмены операций по трансплантации органов в европейских клиниках до сгнивших цветов и фруктов на складах Кении и Замбии – обошелся мировой экономике в 5 миллиардов долларов [72].

Новая социальная сложноорганизованность и концентрация никак не повлияли на извержение вулкана, однако, когда это произошло, они значительно повысили стоимость нанесенных им убытков.

Другие крупные сбои инфраструктуры остаются на нашей совести. В августе 2003 г. на северо-востоке США и в Канаде произошло самое серьезное отключение электроэнергии в североамериканской истории. Оно на 30 часов оставило без света более 50 миллионов человек, стоимость ущерба составила от 6 до 10 миллиардов долларов [73]. До этого момента лишь немногие в правительстве или коммунальных службах предполагали, что отключение такого масштаба вообще возможно. Но в США потребление электроэнергии за последние десять лет подскочило почти на 30 %, не в последнюю очередь из-за появления интернета. Дерегулирование и приватизация, начатые в начале 1990-х гг., увеличили число подключений к общей электрической сети с сотен до тысяч. Новые интеллектуальные энергосистемы, подключенные к стареющим электростанциям, усложнили систему управления. Широкое использование источников возобновляемой энергии (которые начинают и заканчивают работу в соответствии с капризами солнца и ветра) усложнило балансировку нагрузки на сеть. Неудивительно, что объединенная оперативная группа США и Канады, собранная для ликвидации последствий аварии, пришла к выводу, что главными причинами отключения были «недостаточное понимание системы» и «недостаточная осведомленность о ситуации» [74].

Разумеется, эти эпизоды из недавнего прошлого привлекли наше внимание к системным опасностям инфраструктуры. В общей сложности за первые пятнадцать лет XXI в. стихийные бедствия преподали всему миру уроки на сумму около 2,5 триллиона долларов [75]. И хорошо, что мы имели возможность выучить эти уроки, поскольку на горизонте вырисовывается множество других неприятностей. Несмотря на пестрое разнообразие товаров, путешествующих по мировым транспортным маршрутам, способы их доставки далеко не так разнообразны. Сегодня всего 30 главных аэропортов мира пропускают более 40 % всех международных пассажирских потоков и более двух третей всех международных грузовых перевозок [76]. В десяти главных морских портах мира сосредоточено 50 % глобального контейнерного трафика [77]. Малаккский пролив, основное связующее звено между Индийским и Тихим океанами, по которому проходит четвертая часть всемирного товарооборота, в самой узкой точке имеет ширину всего 2,8 километра. Аденский залив, соединяющий Средиземное море и Индийский океан через Суэцкий канал, играет в мировом торговом судоходстве такую же роль и почти не отличается по размеру. Огромное количество важных для нас товаров производит и поставляет постоянно сокращающийся ряд глобальных платформ.

Это особенно верно для интернета, совершенно нового источника системного риска в XXI в. Интернет настолько полезен, что теперь мы используем его для всего, и в этом заключается опасность. С точки зрения пользователя, интернет представляет собой невидимое поле, которое соединяет нас повсюду. Но у этого пользовательского опыта есть вполне материальная сторона – дата-центры и оптоволоконные кабели, в которых небезопасным образом концентрируются наши соединения. Те же узкие проливы и каналы, через которые проходят корабли со всего мира, являются одновременно лучшими маршрутами для прокладки подводных кабелей. Каждый год в Африке прекращают работу сети электроснабжения целых стран, когда один из этих кабелей перерезает якорь проходящего корабля – или перерубает чей-то топор. В 2013 г. служба береговой охраны Египта задержала троих мужчин в рыбацкой лодке, которые пытались перерубить кабель, идущий по дну Суэцкого канала. Целью их атаки были кабели системы SEA-ME-WE 4, одного из главных каналов передачи данных между Европой, Африкой и Азией. Перерезав их, они отключили бы интернет на всех трех континентах. Возможно, некоторые правительственные организации сейчас обладают возможностью задействовать «убойную кнопку», то есть гарантированно заблокировать в определенной стране интернет, например путем отключения важных серверов. Это может объяснить, почему в Северной Корее в ноябре 2014 г. на короткое время исчез интернет, спустя несколько дней после того, как правительство США обвинило Корею по взломе Sony Pictures в ответ на недавно выпущенный сатирический фильм о северокорейском режиме.

Тем временем сложноорганизованность сетевого оборудования и программного обеспечения все больше затрудняет бесперебойное оказание услуг. Google, Microsoft, Amazon и Facebook эксплуатируют около 1 миллиона серверов каждый, и простои – из-за программных сбоев, стихийных бедствий, отказа оборудования и человеческих ошибок – дорого обходятся этим компаниям. Незапланированные потери данных за время простоя в 2014 г. обошлись им примерно в 1,7 триллиона долларов [78]. Чем более зависимыми от интернета мы становимся, например за счет более широкого внедрения облачных услуг, тем выше будут становиться эти затраты [79]. А эксплуатация так называемых «уязвимостей нулевого дня» – неизвестных ошибок, спрятанных глубоко внутри кода широко распространяемого программного обеспечения или операционной системы, – позволяет намеренно саботировать эти услуги. Часто подобные ошибки замечают и исправляют только после того, как хакеры ими воспользуются. В сентябре 2014 г. волна атак, получившая название ShellShock, обрушилась на операционные системы Mac и Linux, используя внутренние программные ошибки для запуска вредоносного кода на миллионах компьютеров. Ошибка, которой воспользовались злоумышленники, оставалась незамеченной в течение двадцати лет. Еще одна уязвимость нулевого дня, обнаруженная в ноябре 2014 г. и получившая название Unicorn, присутствовала во всех выпусках Microsoft Internet Explorer начиная с 1995 г. [80].

Сложность интернет-сетей позволяет производить хакерские атаки с почти абсолютной анонимностью. Наиболее частая разновидность такой атаки, распределенный отказ в обслуживании (DDoS), организует одновременную отправку фиктивных запросов на сервер жертвы с тысяч взломанных компьютеров, в результате чего добросовестные пользователи не могут получить доступ к нужному сайту. Изначально интернет был создан для совместного использования, а не для безопасности, поэтому теперь преступники могут скрыться у всех на виду среди ничего не подозревающей толпы, которую сами же создают. Даже когда преступник обнаружен – часто где-то за границей, – юридическая волокита затрудняет привлечение его к ответственности.

Двадцать лет назад киберпреступность была редким явлением, сегодня с ней можно столкнуться повсюду: в нашей электронной почте, в интернете, в социальных сетях, на мобильных устройствах и во внутренних корпоративных сетях. Ее быстрое распространение стало возможным благодаря развитию торговых онлайн-площадок, которые снабжают злоумышленников исполнителями и инструментами и обеспечивают спрос на украденное. Вопрос не в том, станете ли вы жертвой киберпреступности, – вопрос в том, когда это произойдет. Злоумышленники наносят нам непосредственный ущерб – крадут наши деньги и идентификационные данные, логины и пароли, видео с веб-камеры или фотографии в Snapchat. Они используют нас, чтобы нанести вред другим людям, делая нас невольными соучастниками спама, фишинга и атак по электронной почте или перекачивая через наши компьютеры вредоносные программы и детскую порнографию. И чем больше умных устройств, от бытовой техники до автомобилей и замков в нашем доме, подключается к «интернету вещей», тем больше возможностей нанести вред появляется у киберпреступников. В июле 2015 г. около 1,4 миллиона внедорожников было отозвано, когда исследователи доказали, что могли бы использовать программную ошибку машины для того, чтобы удаленно через интернет взломать ее систему управления и спровоцировать аварию [81].

Киберпреступники крадут интеллектуальную собственность и производственные секреты у организаций. В 2014 г. примерно половина малых предприятий, две трети средних компаний и четыре пятых крупных предприятий по всему миру стали мишенью киберпреступников [82]. Кит Александер, руководитель Агентства национальной безопасности США до 2014 г., называл кибершпионаж «величайшей передачей богатства в истории» [83]. Только в США, где совершается половина всех кибератак, корпоративные потери от кибершпионажа составляют от 300 до 400 миллиардов долларов в год [84]. Эти нападения также наносят вред покупателями и клиентам, нарушая конфиденциальность их личных данных и делая их более уязвимыми для кражи. Исследование, проведенное в 2014 г., показало, что 43 % американских фирм, в том числе крупнейшие интернет-провайдеры, торговые предприятия и банки, пострадали от хищения данных [85]. Хакеры, атаковавшие банк JPMorgan Chase & Co., украли банковские записи 76 миллионов домохозяйств и семи миллионов предприятий малого бизнеса [86]. Сети передачи данных общего пользования также находятся в опасности. В апреле 2007 г. Эстония, которая одной из первых в мире перешла на безбумажное управление и интернет-банкинг, была вынуждена приостановить всю внутреннюю деятельность, когда ее банки, телекоммуникационные компании, СМИ и правительственные организации подверглись одновременным массированным DDoS-атакам. Совсем недавно, в середине 2015 г., из Отдела управления кадрами правительства США в результате взлома были украдены кадровые данные 21,5 миллиона нынешних и бывших сотрудников правительства, в том числе 5,6 миллиона изображений отпечатков пальцев – возможно, это сделали иностранные правительства с целью вербовки информаторов и обнаружения шпионов [87]. Другие изощренные вредоносные атаки, вероятно, также осуществленные при иностранной поддержке, взламывали базы данных посольств, научно-исследовательских институтов и других правительственных организаций по всему миру [88].

Рост масштабов важнейшей инфраструктуры, подключенной к интернету, в том числе оборонной, химической, пищевой, транспортной, ядерной, водной, финансовой, энергетической и других систем, означает, что теперь возможна не только киберпреступность, но и кибервойна. По состоянию на 2016 г. были официально подтверждены две крупные кибератаки, вызвавшие выход из строя материальной инфраструктуры. В 2010 г. в Иране компьютерный червь Stuxnet саботировал завод по обогащению урана, заразив систему управления и вызвав поломку урановых центрифуг [89]. (Аналогичный червь был направлен на промышленные объекты Северной Кореи, но не смог достичь цели из-за крайней изоляции страны [90].) В 2014 г. немецкому сталелитейному заводу был нанесен «огромный ущерб» после того, как злоумышленники получили доступ к системам управления завода и спровоцировали отказ критических компонентов [91]. Предпринимается множество подобных попыток. Министерство внутренней безопасности США сообщило о 245 серьезных инцидентах в 2014 г., в основном в энергетическом и ключевых производственных секторах, начиная от несанкционированного доступа к вредоносным инфекциям и заканчивая кражей данных (которые могут послужить материалом для подготовки следующей атаки) [92].

Прошли те дни, когда мы могли воспринимать любую инфраструктуру как нечто само собой разумеющееся.


Природа как инфраструктура

То же касается и природы. Естественная инфраструктура (например, климат) является ярким примером того, как изменились опасности со времен предыдущего Ренессанса и какие уроки пятисотлетней давности до сих пор актуальны.

Изменились в первую очередь масштабы человеческой деятельности, помноженные на выросшую в 17 раз численность населения, и технологии, которые теперь потребляют гораздо больше энергии [93]. Пятьсот лет назад силы природы, казалось, были никак не связаны с деятельностью человека. Люди могли изменить пейзаж сельскохозяйственными работами или вырубкой леса, но в основном природу воспринимали как данность – силу, находящуюся за пределами нашего влияния и тем более не поддающуюся нашему контролю. Сегодня все изменилось. Четкой границы между деятельностью человека и стихийными бедствиями больше не существует, поскольку масштабы человеческой деятельности ощутимо влияют на места обитания животных, видовое разнообразие, погоду, температуру, атмосферу и даже на высоту уровня моря.

Урок в этой области не менее очевиден: соединяющие и развивающие силы порождают сложноорганизованность и концентрацию, а также связанные с ними проблемы. Возьмем для примера изменение климата. Отношения человечества с климатом Земли стали одним из самых сложных явлений в науке. Природные факторы, на которые опирается понимание этого отношения, включают в себя, среди прочего, солнечные циклы, колебания орбиты Земли, атмосферные и океанические течения, циклы поглощения и высвобождения углекислого газа растительным и животным миром, а также поглощающую способность разных видов поверхности планеты. К этим явлениям нужно добавить также влияние человеческого общества: ускоренное производство парниковых газов, освоение земельных угодий, истощение озонового слоя, сельское хозяйство, вырубка леса и т. д. После этого начинается самое сложное – необходимо обнаружить внутренние и внешние взаимодействия, обратные связи и нелинейные точки перелома этих двух гигантских наборов переменных. Разглядеть причину и следствие очень трудно. Это наполовину объясняет, почему так сложно уговорить общественность ослабить давление на климат, даже когда мы непосредственно страдаем от последствий этого давления – изменения погодных условий, сильных ураганов и других «природных» бедствий.

На вторую половину причина состоит в том, что изменение климата представляет собой парадигматическую дилемму концентрации. Это совершенно непреднамеренный побочный продукт человеческой инициативности, жажды приключений и открытий, налаживания связей и сотрудничества – словом, разнообразных видов деятельности, которые мы считаем положительными. Что нам делать, если, преследуя каждый по-своему социально одобряемые цели, мы способствуем накоплению углеродного загрязнения, которое, вероятнее всего, представляет серьезную угрозу нашему существованию?


Опасности процветают, и виноваты в этом растущая сложноорганизованность и концентрация нашей социальной системы.

Эти два фактора влекут за собой разные проблемы. Если говорить о сложноорганизованности, самая трудная часть решения проблемы – это заметить ее. Если бы мы могли увидеть, как работают причинно-следственные связи, мы защитили бы себя с помощью организационных и технологических решений, – но мы не можем, поэтому ничего не делаем.

Сложноорганизованность подрывает нашу дальновидность, концентрация подрывает нашу устойчивость. Концентрация является коллективным следствием наших индивидуальных решений, которые мы принимаем, руководствуясь свободой воли, честолюбием, долгом перед близкими. Что нам делать, когда наши частные действия увеличивают риск коллективных потрясений, хотя мы никогда к этому не стремились? Даже когда мы видим, что потрясение уже близко, простого ответа нет.

Мы не можем избежать этих проблем. Они – обратная сторона пронизанной взаимосвязями, быстро развивающейся эпохи, в которую мы родились, и они проникают в нашу жизнь – в том числе, как покажет следующая глава, в наши отношения друг с другом.

7

Костры и сопричастность

Как нынешнее время дает силу экстремистам и ослабляет объединяющие нас связи

Вся Италия воюет,

Глад и мор ее трясут.

Божий бич, как ветр, бушует,

И вершится Божий суд.

Пробавляйтесь скудной пищей —

Жизнью призрачной и нищей.

Маловерам и слепцам —

Горе вам!

Джироламо Савонарола (1452–1498) [1][31]

Возвышение пророков

В начале февраля 1497 г. монах-доминиканец Джироламо Савонарола с группой фанатичных молодых последователей собрали все, какие только смогли, осязаемые свидетельства необыкновенной новой эпохи – безнравственные книги, еретические тексты, обнаженные статуи и картины с нескромными фигурами, непристойные ароматы, новые музыкальные инструменты, безделушки из дальних стран – и сложили из них на центральной площади Флоренции гигантское сооружение высотой около 20 метров, семь ярусов которого символизировали число смертных грехов. 7 февраля, в день карнавала, Савонарола поджег сооружение – это событие вошло в историю как Костер тщеславия.

Сам по себе этот акт был не слишком примечательным. Итальянские священники и раньше разводили общественные костры, на которых сжигали грехи, – так делал Бернардино да Сиена в 1420-х гг. и еще позже, в 1483 г., Бернардино да Фельтре [2]. Ничего нового не было и в словах Савонаролы. Он громко и весьма талантливо выступал против морального разложения в обществе и попустительства церкви – но то же самое говорили до него многие проповедники [3].

Возможно, в другом месте и в другое время на Савонаролу просто не обратили бы внимания. Он был, в конце концов, одиноким проповедником, выступавшим против богатой знати и религиозных институтов, державших в руках всю официальную власть. Однако случилось так, что его идеи приобрели огромное влияние, совершенно не соответствующее его социальному положению, и распространились с такой скоростью, что это застигло врасплох представителей власти, от клана Медичи во Флоренции до папы Александра VI в Риме. В мае или июне 1490 г., когда в возрасте тридцати восьми лет Савонарола впервые приехал во Флоренцию, чтобы занять должность наставника в монастыре Сан-Марко, он был обыкновенным монахом из Феррары с небольшой, но неуклонно растущей репутацией, заработанной благодаря волнующим апокалиптическим проповедям. Через год он уже проповедовал в самом известном соборе города, Дуомо, под куполом Брунеллески, перед пятнадцатитысячной толпой [4]. Как монах и не гражданин Флоренции, он был дважды неподходящей кандидатурой для избрания на государственные должности; тем не менее с 1494 г. и до его казни в 1498 г. он оставался самой влиятельной фигурой флорентийской политики. Он управлял городом как теократическим государством, где царем был Христос, и его моральный и политический авторитет распространялся повсюду [5]. Его сторонники образовали крупнейшую партию в Советах, управлявших Флоренцией, и с их помощью он преобразовал город, совершив двойную революцию: во-первых, республиканское движение опрокинуло державшийся шестьдесят лет режим Медичи, при котором все руководящие места занимала знать, и передало власть более представительному Большому совету; и во-вторых, была развернута общественная кампания по очищению нравов, ужесточившая законы против порока, терроризировавшая проституток и содомитов и поощрявшая публичные проявления раскаяния, кульминацией которых стал исторический Костер тщеславия. В своих проповедях Савонарола называл город «христианская религиозная республика Флоренция» [6].

Отчасти быстрый взлет Савонаролы, который дал ему власть принимать революционные решения, был обусловлен удачным выбором времени. Он проповедовал об Апокалипсисе, и обстоятельства подтверждали его слова. Приближался 1500 г., и многие христиане ждали его в ужасе, уверенные, что близится день Страшного суда. Казалось, все указывало на близкий конец света. Османская империя маячила на горизонте как мрачная туча: она уже отрезала Азию, оккупировала Грецию и теперь наводила ужас на итальянское побережье. Патриарх клана Медичи, Лоренцо Великолепный, фактический правитель Флоренции и источник могущества и великолепия города, заболел и умер в 1492 г. Его невзрачный наследник Пьеро Невезучий не вызывал у людей никакого доверия. В 1494 г. сомнения народа полностью оправдались: французский король Карл VIII вторгся в Италию, принес с собой сифилис и забрал огромное количество сокровищ Флоренции, которые Пьеро передал ему, пытаясь купить мир. В общих чертах Савонарола уже предсказал все это: если люди не смоют грехи, которые развращают общество и их собственные сердца, то Бог пошлет новый потоп, чтобы сделать это за них.

Отчасти влияние Савонаролы было связано с атмосферой стремительных изменений, в которой он жил, и с опасениями, которые эти перемены внушали людям. Многие флорентийцы, особенно представители творческих профессий, вдохновлялись учением гуманистов, призывавшим поднять человека выше в Великой цепи бытия, найти божественную искру в художественных, научных и политических стремлениях. Савонаролу и его единомышленников это приводило в ужас. Поднять в иерархии общественных ценностей материальную красоту и светские достижения значило развенчать религиозные ценности – воздержание и покаяние. Деву Марию изображали как миловидную богатую женщину – и этот образ разжигал в мужчинах вожделение [7]. Папа Александр VI (более известный под своим фамильным именем Борджа) был слишком увлечен мирскими делами. История свидетельствует, что он содержал множество любовниц и пренебрегал духовными обязанностями, вместо этого пользуясь своим положением, чтобы обеспечить членам своей семьи высокие посты и незаслуженные богатства. Савонарола призывал людей не забывать о том, что рай и ад – вполне реальные места. К спасению ведут не попытки человека подняться выше себя самого, а повиновение нравственным законам Бога и надежда на Его милосердие в жизни после смерти. Только в духовном Ковчеге Иисуса Христа люди могут спастись от грядущего потопа. Те, кто верил в эти догматы, считали, что культуру нравственной вседозволенности, укоренившуюся в церкви и обществе, необходимо искоренить. Опираясь на эти убеждения, Савонарола ужесточил обычаи и наполнил их новым смыслом и злободневностью. Он взял под свой контроль существовавшие во Флоренции школы для мальчиков в возрасте 12–18 лет и переписал их программу. В результате школы превратились в конвейер по производству фанатичной идеологизированной молодежи, которая патрулировала улицы и обеспечивала выполнение нравственной программы Савонаролы путем запугивания, преследования и насилия [8].

Но больше всего Савонарола был обязан своим невероятным влиянием тем соединяющим и развивающим силам, которые пронизывали его мир. Флоренция превращалась в один из крупных культурных и торговых центров Европы. Идеи, высказанные во Флоренции, расходились так же далеко, как когда-то расходились слова, произнесенные в амфитеатре Рима. Эта закономерность прослеживалась и раньше в искусстве, банковской деятельности и политике. Савонарола усилил широковещательные возможности города с помощью печатного станка. Да, он призывал людей вернуться к ценностям прошлого, но не стеснялся пользоваться для этого новыми технологиями. Если история не ошибается, он был первым итальянским политиком, который использовал печатный станок как средство массовой пропаганды [9]. Он публиковал свои воззвания в виде коротких памфлетов – их можно было быстро набрать и дешево отпечатать [10]. Кроме того, он изобрел «открытое письмо», адресованное всем, кто его прочитает, и предназначенное для формирования общественного мнения [11]. С помощью этих новых инструментов он рассуждал о нравственных заботах и вкладывал в них все больше энергии, пока его движению не стало трудно, а затем и опасно сопротивляться.

Новые костры

Сегодня мы могли бы назвать Савонаролу реакционером или агрессивным экстремистом – некоторые современные ученые так и делают [12], особенно когда речь заходит о его яростной кампании против «того проклятого порока содомии, которым, как вы знаете, Флоренция печально известна на всю Италию. Примите закон, говорю я, чтобы таких людей забрасывали камнями и сжигали без всякой жалости» [13].

Есть и различия. Сегодняшний экстремизм омрачает не только христианство, но и все мировые религии, в том числе ислам, иудаизм и даже буддизм. Маргинальные христианские конфессии, перебравшиеся из США в Уганду, распространяют исламофобию и гомофобию и совершают акты остракизма и насилия в отношении живущих среди них мусульман и гомосексуалистов [14]. Ультраортодоксальные евреи в Израиле атаковали гей-парады и планировали взорвать арабскую школу для девочек [15]. Излишне усердные монахи в Мьянме, где большинство населения составляют буддисты, подстрекали толпу сровнять с землей поселения мусульманских меньшинств [16]. Религиозный радикализм – лишь один из видов экстремистской деятельности. Экстремизм имеет множество обличий, от ультранационалистов в Индии, которые нападают на меньшинства из страха, что культурный плюрализм превратит их самих в меньшинство в их собственной стране, до ксенофобских неонацистских групп, которые усердно пытаются изгнать из Европы неевропейцев.

Но есть и существенные параллели. И тогда, и сейчас укоренившиеся идеологические программы вдруг приобретают новое влияние и масштаб. Костер Савонаролы дает нам три урока об экстремизме в его современном виде.


Этого следует ожидать

Прежде всего его следует ожидать. Экстремизм является такой же частью нынешнего времени, как расцвет гения и системные опасности. Это предсказуемое последствие реакции некоторых кругов на быстрые социальные изменения, а также появление новых ресурсов и технологий, позволяющих мобилизовать эту реакцию и усилить ее голос. Быстрый взлет и широкая география деятельности Исламского государства (ИГИЛ) были бы невозможны 20 лет назад. Движение «Талибан» в 1990-е гг. было племенной, локализованной силой, Аль-Каида является безгосударственным сетевым образованием, но ИГИЛ в 2010-х гг. представляет собой современный, расширяющийся территориальный режим. Социальные сети сыграли решающую роль в его приходе к власти. Серия сенсационных террористических атак и обезглавливаний, доведенных до сведения всего мира, а также изощренная, искусно организованная пропагандистская кампания, объединяющая молодых мужчин-суннитов, недовольных плохим обращением правительства с мусульманами-суннитами, сплотили под знаменем ИГИЛ множество недовольных иракцев, сирийцев и иностранцев [17]. Начиная с 2011 г. к ИГИЛ присоединилось около 30 тысяч иностранцев более чем из ста стран, в том числе около 5000 из Европы и Северной Америки. Это был самый успешный набор иностранных боевиков со времен гражданской войны в Испании в конце 1930-х гг. [18]. Этот успех плюс оружие и финансовая поддержка международной сети джихадистов позволили ИГИЛ нанести военные удары, в результате которых в июне 2014 г. оно взяло под свой контроль Мосул (второй по величине город Ирака с населением 1,2 миллиона человек), а еще через месяц захватило 60 % нефтяных месторождений Сирии – и все это произошло быстрее, чем национальные и международные органы власти успели принять ответные меры. Эти победы, в свою очередь, дали ИГИЛ самообновляющиеся финансовые ресурсы, позволившие увеличить армию и начать решать серьезные задачи государственного строительства, укрепляя свои позиции в качестве нового, возможно, постоянного фигуранта ближневосточной политики.

Как и системные опасности, описанные в предыдущей главе, сегодняшние реакционные и экстремистские силы нельзя уничтожить. Популярная, но ошибочная точка зрения гласит, что экстремизм можно подавить с помощью образования. Но Савонарола был весьма образованным человеком. Он прекрасно разбирался в праве, философии, теологии и гуманитарных науках и тем не менее выступал за сожжение книг и избиение камнями проституток, а также учил, что однополый секс, к которому флорентийцы относились в общем терпимо, заслуживает смертной казни. Так же и главные творцы современных экстремистских движений нередко бывают весьма образованными людьми с естественно-научными, медицинскими и инженерными дипломами [19]. Террористы-смертники в израильско-палестинском конфликте в три раза чаще имеют высшее образование, чем население в целом [20]. Две трети террористов, спланировавших и осуществивших угон самолетов 11 сентября 2001 г., посещали университеты [21]. Лидер Исламского государства Абу Бакр аль-Багдади в совершенстве владеет классическим арабским языком и, по некоторым данным, имеет несколько ученых степеней в исламоведении [22].


Конкурирующие взгляды на современность

Образование не способно уничтожить сегодняшний экстремизм, поскольку он коренится не в невежестве. И не в радикальном отказе от всего современного. Второй урок Савонаролы заключается в том, что экстремизм тогда и сейчас коренится в совершенно ином представлении о современности.

Что такое современность? Постмодернисты, а затем и постпостмодернисты в течение многих десятилетий доказывали нам, что на этот вопрос не существует единого правильного ответа. Все противоположности, которые мы выделяем, – прогресс и регресс, рациональное и иррациональное, современное и традиционное – не являются истиной. Это только оценочные суждения. Просто некоторые из них очень широко распространены, и это придает им вид истины, поскольку мы редко встречаем людей, которые с ними не согласны. Тех немногих, кто это делает, мы называем экстремистами, – что, следовательно, переносит нас самих в категорию людей умеренных взглядов. В основе умеренных и экстремистских взглядов на современность лежит одна и та же идея – что человечество может стать лучше. Обе концепции стремятся двигать нас вперед. Но в то время как люди умеренных взглядов измеряют это улучшение в общих, широко признаваемых светских достижениях (здоровье, богатство, преимущества образования), совместимых с рядом других ценностей, экстремисты, такие как Савонарола, обычно определяют улучшение как выполнение конкретных религиозных или нравственных условий, которые оставляют мало места для компромисса. Те же взаимосвязи и технологии, которые позволяют развивать умеренные принципы, позволяют и экстремистской идеологии достичь новых высот чистоты.

Концепция Савонаролы была вполне современной – он не пытался вернуть общество в средневековое прошлое, он пытался – с помощью новых способов трансляции своей идеологической программы, контроля за общественной деятельностью и наказания неверующих – усовершенствовать нравственные порядки, сделать их лучше, чем раньше. Он представлял себе Флоренцию как Новый Иерусалим, который в своих политических и социальных уложениях воплотил бы нравственные добродетели более последовательно и убедительно, чем даже старый Иерусалим. Сходная мотивация сегодня движет Исламским государством, за исключением того, что вместо Нового Иерусалима лидеры ИГИЛ намереваются создать новый халифат, в котором полнее, чем когда-либо, будет воплощено их понимание учения пророка Мухаммеда. Их цель – не просто наказать неверных за границей, но реорганизовать мусульманский мир. В своем первом публичном выступлении в качестве самопровозглашенного халифа Исламского государства в июле 2014 г. Абу Бакр аль-Багдади заявил:

…Мы живем сегодня в новую эпоху. Поднимите голову высоко, ибо сегодня, милостью Аллаха, у вас есть государство и халифат, который вернет вам достоинство, силу, права и руководство. Это государство, где араб и не араб, белый человек и черный человек, житель Востока и житель Запада – все они братья… Аллах соединяет их сердца, и они становятся братьями милостью Его… Их кровь смешивается и становится единой, под единым знаменем и целью, в одном дворце, радуясь этому благословению, благословению верного братства… Спешите же, о мусульмане, к своему государству [23].

Халифат в исламе обладает особым статусом. Это не государство с традиционными границами, а суверенная власть над всеми правоверными мусульманами во всем мире. Если это законный халифат, все мусульмане обязаны прибыть туда и стать его частью. Первый халифат был создан непосредственным преемником пророка Мухаммеда в 632 г.[32], последний прекратил свое существование после Первой мировой войны, с расколом Османской империи на Турцию и несколько арабских государств. Исламское государство стало первой мусульманской группой, объявившей о создании нового халифата после этих событий, и, хотя ни одна страна с преобладающим мусульманским населением не признает его как таковой, к концу 2014 г. ИГИЛ уже сделало несколько широких шагов к своей цели. Оно укрепило военный контроль над территорией Ирака и Сирии, в совокупности превосходящей территорию Великобритании. Оно захватило и реорганизовало функции правительства (суды, полиция, здравоохранение, образование, инфраструктура, экономическая и денежно-кредитная политика и т. д.) в оккупированных районах. Оно обеспечило себе доход около 3 миллиардов долларов в год за счет нефти и газа, сельского хозяйства, налогов, а также вымогательства и разграбления предметов старины и пожертвований, что сделало его самым богатым фундаменталистским движением в мире [24].

Сочетая террор с пропагандой, ИГИЛ реформирует социальные нормы в соответствии со своими убеждениями. ИГИЛ придерживается весьма примитивного толкования ислама, рассматривая всех, кто не согласен с его интерпретацией (в том числе других мусульман), как неверных и поощряя по отношению к ним насилие, возведенное в разряд религиозного долга. В некоторых районах, в настоящее время находящихся под контролем Исламского государства (провинция Ниневия в Северном Ираке и др.), на протяжении многих веков проживало мультикультурное многоконфессиональное население. Теперь этнические и религиозные меньшинства должны перейти в другую веру, бежать либо подвергнуться пыткам, изнасилованиям и убийствам; бродячие банды религиозной полиции искореняют пороки и заставляют всех посещать молитвы; преподавание искусства, музыки, отечественной истории, литературы и христианства запрещено; гомосексуалистов убивают; женщины обязаны подчиняться строгим правилам, которые указывают им, что делать, что носить и когда они могут выходить из дома; детей, достигших девяти лет, превращают в солдат [25].

Экстремистские и умеренные представления о современности плохо сочетаются друг с другом. В их глазах одно удовлетворяет свои аппетиты ценой морального разложения, а другое обеспечивает «чистоту веры» ценой свободы личности. Не в силах примирить эти ценностные противоречия, Савонарола счел необходимым устранить духовных и светских лидеров, против политики которых он выступал. Но папа никуда не собирался уходить. Как и итальянская знать, которой не нравились республиканские реформы Савонаролы. В 1497 г. папа Александр VI запретил Савонароле читать проповеди и, когда тот нарушил этот запрет, отлучил его от церкви. Несмотря на предсказания Савонаролы, небо не упало на землю (что не преминули отметить его политические противники), и поддержка народа начала ослабевать. В мае следующего года, через 15 месяцев после того, как Савонарола поджег свой знаменитый Костер тщеславия, он был повешен и сожжен на той же площади, а его пепел бросили в реку, чтобы не оставлять мученических реликвий, которые могли бы воспламенить кого-нибудь другого. (Той же логикой руководствовался американский спецназ, в 2011 г. похоронивший тело Усамы бен Ладена в море.) Сегодня столкновение между альтернативными вариантами современности снова порождает насилие, но в более широком масштабе. Аль-Каида, Исламское государство и другие экстремистские организации выступают за неизбирательное насилие в отношении неверующих во всем мире, – чего Савонарола, боровшийся за душу Флоренции, все же не делал.


Подогретые разочарованием

Костры предыдущего Ренессанса предлагают нам лучший способ борьбы с экстремизмом: последовательно выполнять обещания умеренного мира, чтобы больше людей чувствовали поддержку и меньше чувствовали себя обманутыми временем, в котором они живут. Италии при Савонароле это не удалось. Хотя в этом не было ничего сложного. Простые крестьяне, поддерживавшие учение Савонаролы, и не ждали многого от этого мира – они воспринимали огромный социальный и экономический разрыв между собой и знатью как часть естественного порядка вещей. Они существовали в обыденном мире, простиравшемся во все стороны примерно на пятнадцать километров – зачем им было ехать дальше? Они никогда не пробовали пряности Нового Света – зачем им было этого хотеть? Они не видели большой пользы в грамотности и книгах и не имели средств получить то или другое. Им было вполне достаточно полагаться на Бога, который поставил Землю в центре мироздания и запустил вокруг нее Солнце, и на Его милосердие, изгоняющее демонов лихорадки и болезни, которые терзали их и их детей.

Для многих простых людей спасение было единственным обещанием, которое им давало общество и которое оно должно было сдержать. Но теперь даже Божьи посланники, чья единственная задача состояла в том, чтобы обеспечить присутствие Бога в жизни народа, начали открыто щеголять богатством и пороком. Единственная общественная организация, чьей обязанностью было соблюдать интересы простых людей, оказалась захвачена знатью, которая преследовала собственные интересы. Многие восприняли это как окончательное предательство. Поддержка разочарованных масс дала Савонароле возможность отобрать у богатых и благородных светскую власть и имущество, составлявшее предмет их тщеславия.

Это разочарование снова повторяется. Умеренная современность кажется фикцией сторонникам экстремистских движений, таких как Исламское государство. По словам его лидера, развитый мир «распространяет прельщающие и обманчивые лозунги – цивилизация, мир, сосуществование, свобода, демократия… среди многих других ложных лозунгов», но на практике «порабощает мусульман» и вынуждает либо «жить подло и позорно, послушно повторяя эти лозунги, забыв о воле и чести», либо «быть обвиненным в терроризме», если этого не делать [26].

Отчасти разочарование обусловлено экономическими причинами. В главе 3 мы отмечали, что глобальный рост благосостояния населения омрачается серьезным экономическим неравенством. Нигде в мире экономическое неравенство не проявляется так наглядно, как на Ближнем Востоке. Сирия – молодое государство, 40 % ее 23-миллионного населения составляют молодые люди в возрасте до 24 лет. Туда, куда они пойдут, последует и будущее страны. К моменту начала гражданской войны в Сирии в 2011 г. 48 % молодежи были безработными, при этом три четверти из них оставались без работы дольше одного года [27]. Отчасти в этом были виноваты засухи, не прекращавшиеся с 2001 г. в и без того засушливом регионе (многие ученые связывают это с изменением климата): за десять лет почти миллион крестьян отказались от своей земли и заполонили города [28]. Государственная политика Башара аль-Асада только усугубила эти проблемы. В стране была распространена всеобщая грамотность, но учебные программы устарели и не могли привить студентам необходимые профессиональные навыки. Убыточные государственные органы управления и широко распространенная коррупция затрудняли получение социальной помощи. В стране было почти невозможно получить кредит, коммерческие права не соблюдались, а контракты относились к наименее выполнимым в мире. В 2011 г. Всемирный банк поставил Сирию на 144-е место из 183 стран в рейтинге благоприятности условий ведения бизнеса [29]. К 2015 г. она опустилась на 175-е место [30]. «Арабская весна» показала, что разочарованная молодежь, которой преграждают путь к процветанию и умеренным взглядам, начинает искать альтернативу.

Разочарование также носит политический характер. Нури аль-Малики, премьер-министр Ирака с 2006 г. (когда после войны в Ираке временное правительство передало ему власть) и до своего свержения в 2014 г., собрал правительство, в котором преобладали мусульмане-шииты, и всячески поддерживал их интересы. Среди населения Ирака насчитывается около 60–70 % шиитов, однако в 1979–2003 гг. при режиме Саддама Хусейна (суннита) они подвергались крайне жестокому обращению. Аль-Малики, бывший шиитский диссидент, который провел 24 года в изгнании, оказавшись у власти, качнул маятник в другую сторону. Сунниты были изгнаны с ключевых должностей в университетах и правительстве, их лидеры были отстранены от встреч кабинета министров или вынуждены бежать. Простые сунниты столкнулись с повседневной дискриминацией в школах, на работе и в судах. Многим молодым иракским суннитам, уже страдавшим от более чем 20-процентной безработицы, стало ясно, что новый режим не рассматривает их как полноценных граждан [31]. Отсюда было рукой подать до отказа от государства и присоединения к ИГИЛ и другим группировкам, нацеленным на создание нового порядка и установление безраздельного господства суннитов.

Общество, уставшее от невыполненных обещаний, представляет собой легко воспламеняющийся материал. После того как пламя бунта вспыхнет, чтобы лишить его топлива, понадобятся не только военные, но и политические, социальные и экономические меры, которые смогут исполнить законные ожидания граждан – дать им больше возможностей и защитить их достоинство. К сожалению, как свидетельствует гибель Савонаролы, так бывает редко.


Исламский Ренессанс?

Чтобы подавить бунт, необходимы новые идеи – и в этом смысле будущее выглядит более оптимистично. Борьба между умеренными и экстремистскими представлениями о современности – это в конечном счете борьба идей, и если недавние военные успехи Исламского государства очевидны, то его успехи в борьбе за сердца и умы арабского мира вызывают немалый скептицизм. В арабском мире преобладают сомнения, главным образом среди молодых людей (к чьей готовности ломать и разрушать обычно обращаются все экстремистские движения от Савонаролы до наших дней). В социальных сетях растет число арабской молодежи, выражающей гнев и отвращение в связи с тем, как ИГИЛ извращает ислам, пытаясь узаконить массовые убийства и разрушения. Это побудило их начать высказывать ответные идеи, от более умеренных интерпретаций своей религии до открытого отказа от религиозного управления в пользу светского правительства. Ахлям Мустаганами, алжирская писательница, в своих произведениях критикующая экстремизм, преследование женщин и другие несправедливости арабского мира, собрала почти 8 миллионов лайков на своей странице Facebook. Ежедневное ток-шоу «Черные утки» на арабском языке на канале YouTube, начавшее работу в январе 2015 г., берет интервью у арабских атеистов и агностиков и к концу года набрало 1,5 миллиона просмотров. Целью программы является «установление светского общества на Ближнем Востоке и в Северной Африке» и «поддержка и утешение тайных атеистов, чтобы они знали, что не одиноки в этом мире» [32].

Хотя невозможно оценить, сколько людей в арабском мире разделяют такие взгляды, очевидно, что ни одному экстремистскому движению до сих пор не удалось их искоренить. Те же человеческие, экономические и технологические взаимосвязи, которые помогают ИГИЛ заявлять о себе и поддерживают его радикальные взгляды, помогают последователям противоположных идей находить сторонников, оказывать друг другу поддержку и осознавать значение общего голоса.

«Ренессанс» означает «возрождение». В этой книге мы в основном используем этот термин в более широком смысле, подразумевая эпоху расцвета гения и новых опасностей, однако у арабского мира есть шанс в XXI в. вплотную приблизиться к буквальному значению этого слова. Тем, кто ведет войну идей против современного исламского экстремизма, нужно лишь оглянуться на предыдущий Ренессанс, и они убедятся, что альтернативная арабская современность вполне возможна. В те времена, как мы уже видели, ислам был в некотором смысле более умеренной религией. Османская империя, по сравнению с доколумбовой христианской Европой, отличалась (за счет своего центрального географического положения) бо́льшим культурным и религиозным разнообразием, а также устанавливала более благоприятные для иностранцев торговые и политические условия. На пике западной экспансии Османской империи христиане составляли в ней более половины населения. Да, менее строгая нравственность Запада, особенно в вопросах сексуальной морали, тогда, как и сейчас, была главным яблоком раздора. Но христианам (и евреям) нередко разрешали придерживаться собственных законов и обычаев, а при дворе султана и в исламских университетах охотно принимали западных ученых (среди которых, возможно, был и Леонардо да Винчи) в качестве администраторов, солдат и ученых. Европейские правители с завистью смотрели на способность османов поддерживать стабильное, многонациональное и многоконфессиональное государство и постепенно перенимали у них юридические концепции, в конечном итоге ставшие основой европейского общества (например, право иностранцев исповедовать собственные религии).

Времена изменились, но и в следующие века понятийные ресурсы исламской религии и арабской цивилизации увеличивались, а не уменьшались. Теперь они могут обратиться к прошлому и почерпнуть в эпохе Ренессанса уроки, рассказывающие о расцвете и многообразии гения, способные вдохновлять и направлять в настоящем. Эта серьезная задача выходит за рамки нашей книги – мы оставим ее тем, кто лучше подготовлен к поиску сокровищ арабской истории и философии[33]. Но мы все можем приложить усилия для того, чтобы открыть арабскому миру оставшуюся часть знаний человечества. (Из 150 миллионов произведений, напечатанных со времен Библии Гутенберга, на арабский язык до сих пор переведено менее 0,5 % [33].) И все мы можем принять к сведению: разговоры, которые могли бы привести к исламскому или светскому арабскому Ренессансу, уже начались.

Когда основной поток разделяется

Выполняя свои обещания, общество снижает привлекательность альтернативных экстремистских убеждений, а также помогает людям умеренных взглядов держаться вместе. В последней главе мы перечислили системные опасности, которые накапливаются в государственных системах здравоохранения, экономики, в инфраструктуре и в природе. Но наши социальные системы также становятся все более уязвимыми для системных потрясений.

Социум – это люди, живущие вместе, а социальная система – это договор об условиях сосуществования, подкрепленный общими нормами и ценностями, а также учреждениями (правительства, суды, центральные банки и т. п.), с помощью которых эти общие понятия принимают конкретную форму. В ренессансные моменты этот общественный договор подвергается повышенному давлению. Да, те силы, которые сегодня трудятся над трансформацией общества, открывают великолепные новые возможности и ужасающие новые опасности. Но этот опыт не может быть одинаковым для всех. Есть великие победы и огромные проигрыши. Удачливые избегают опасностей, несчастные испытывают на себе всю их тяжесть. Развиваются новые концентрации богатства и бедности, и неравномерные результаты подвергают сомнению наши представления о честности и справедливости. В то же время из-за растущей сложноорганизованности нам стало еще труднее разобраться, кто или что стало причиной затронувших нас изменений, и некогда ясные понятия, такие как обязательства и ответственность, тоже становятся неясными.

Честность, справедливость, обязательность, ответственность – эти понятия лежат в основе договора, на котором держится общество. Таким образом, они всегда подвергаются испытаниям; но эпоха Ренессанса ослабляет их именно в тот момент, когда технологии, позволяющие сплотить единомышленников или поднять восстание, внезапно делаются более действенными и распространенными.

Всякий раз, когда наш общественный договор по отношению друг к другу не выполняется, атмосфера единства и жизненные силы, подпитывающие гений, сменяются отчуждением и апатией. Последствия апатии особенно губительны. Нарушения общественного порядка наносят нам тяжелый удар, но мы можем от них оправиться – так же, как мы можем оправиться от материальных потрясений, о которых шла речь в предыдущей главе. Разрушенную башню мы построим заново – такова особенность человеческого духа. Но гораздо труднее построить заново башню, которая так и не была воздвигнута, потому что те, кто мог это сделать, разочаровались или растратили свои силы впустую.


Раскол тогда

После смерти Савонаролы посеянные им семена разочарования продолжали расти и подрывать общественный договор, связывающий людей воедино. В 1503 г. умер папа Александр VI, а его преемник Юлий II (1503–1513)[34], «воинственный папа», продолжал по стопам своего предшественника уводить церковь все глубже в мирские дрязги – причем нередко делал это верхом на коне и в полном вооружении – и все дальше от ее прямой духовной обязанности спасать паству. По мнению верующих христиан, новый папа, занявший римский престол, проявлял аппетит к земной власти, сравнимый с аппетитом другого Юлия – Цезаря. Прочие высокопоставленные священники, следовавшие его примеру, казалось, тоже были гораздо больше озабочены властью над людьми, чем служением им, которому учил Иисус Христос. Вместо бедности они выставляли напоказ свое богатство. На правах крупных донаторов они вмешивались в законодательство. Они открыто тратили деньги – и порой так же открыто предавались разврату, – но при этом продолжали проповедовать по воскресеньям милосердие и добродетель.

В сознании людей начала прорастать мысль о том, что, возможно, «католическая» церковь (от греч. katholikos, «всеобщий») получила это название по ошибке. Если она не представляет их убеждений, значит, чтобы прийти к Богу, ее придется обойти.

Переломный момент наступил в 1517 г., когда один благочестивый монах из немецкого города Майнца увидел, как местный архиепископ продает богатым грешникам индульгенции, чтобы получить деньги на покупку очередного здания для церковных нужд. В знак протеста 31 октября 1517 г. Мартин Лютер прибил свои 95 тезисов, или «Диспут о прояснении действенности индульгенций» (Disputatio pro declaratione virtutis indulgentiarum), к дверям церкви Всех Святых в Виттенберге, тем самым невольно положив начало процессу, который получил название Реформации[35].

Как и Савонарола, Лютер начинал свою карьеру в Римско-католической церкви как монах и священник, проповедовавший принципы строгой экономии и нравственного совершенства. Сам Лютер утверждал, что следует по стопам Савонаролы [34]. Но, в отличие от последнего, Лютер критиковал не только погрязшего в пороках папу, но и институт папской власти в целом. Утверждение, будто между Богом и верующими может стоять человек, имеющий право определять судьбу их душ, было, по его мнению, глубоко порочным. И если вся церковь разделяла концепцию папской власти, значит, церковь следовало полностью отвергнуть. Лютер представлял себе глубоко реформированную церковь, которая отнимет у священников право раздавать Божье прощение и сделает это личным делом, касающимся только Бога и грешников, а также заменит латынь национальными языками, сделав Библию и церковные службы более доступными для понимания простых людей, чтобы они могли лучше позаботиться о своих душах.

Как и в прошлый раз с кампанией Савонаролы, то, что в другое время и в другом месте могло остаться лишь туманной философской критикой, здесь и сейчас нашло отзывчивых слушателей, которые были подогреты разочарованием и готовы к решительным действиям против коррупции, которую видели своими глазами. Но если кампанию Савонаролы в конечном счете задушили те влиятельные люди, которым он угрожал, то идеи Лютера продолжали распространяться до тех пор, пока не погубили их. Они раскололи один из старейших европейских институтов, потрясли властные структуры половины континента и втянули его жителей в продлившуюся более ста лет войну.

Решающую роль сыграло печатное слово, особенно памфлеты. Савонарола открыл убеждающую силы печати – Лютер усилил ее. Поначалу он даже был ошеломлен тем, насколько широко разошлось его послание. Он писал другу:

Я вовсе не хотел, чтобы они [тезисы] распространились так широко. Я намеревался передать их для изучения нескольким знающим людям, и, если бы они не встретили одобрения, избавился бы от них, а если бы их одобрили, распространил бы их посредством публикации. Но теперь их переводят и печатают повсюду, даже за границей, чего я никогда не мог бы одобрить, поэтому я жалею, что произвел их на свет… [35]

Однако Лютер, плодовитый писатель, быстро оценил преимущества случившегося. Одна пятая часть всех памфлетов, изданных в Германии между 1500 и 1530 гг., была подписана его именем: памфлеты позволяли быстро довести свои взгляды до сведения других лидеров общественного мнения, помогали им всем поддерживать контакт, обмениваясь размышлениями и опытом, а также транслировать сообща выработанную программу для более широкой, чем раньше, аудитории [36].


Разобщенные правители, разочарованные массы

Какими бы ни были его первоначальные намерения, Лютер раздул новый костер общественного недовольства. Непримиримая вражда завязалась между теми, кто поддерживал папскую власть, и теми, кто поддерживал предложенный Лютером новый общественный договор, согласно которому Рим полностью лишался всех полномочий (часть из них отныне считалась недействительными, часть переходила в руки светских властей).

Многие правители Европы встали на сторону Лютера и его более инклюзивной «протестантской» концепции – их мотивы, вероятно, варьировались от искреннего духовного поиска до прагматичных политических соображений. Освобожденные теологией Лютера от папского наказания, власти Англии, Дании, Швеции, Германии и Швейцарии начали изымать церковное имущество, захватывать церковные земли, а также передали в руки государства право назначать священнослужителей, организовывать общественное образование, следить за нравственностью и заботиться о бедных. Однако они столкнулись с бурным возмущением убежденных католиков среди собственного населения. Новые гражданские войны, на этот раз на религиозной почве, вспыхнули и распространились по всем государствам Европы. С 1520-х гг. до конца века на континенте менее 10 лет прошло мирно, в следующие полвека – всего два года [37].

Крестьяне и горожане, принимавшие участие в гражданских войнах, сражались не только за веру. Они стремились отомстить правящим классам за многолетнюю эксплуатацию, от которой, согласно реформационной риторике, больше не должны были страдать. Библия – Лютер призывал людей читать ее самостоятельно, и благодаря ему она была переведена на понятный крестьянам язык (немецкий) – познакомила население с радикальными представлениями о том, каким на самом деле следовало бы быть обществу: честный труд должен вознаграждаться, общее благо должно быть защищено от посягательств власть имущего меньшинства. Притеснение знатью простолюдинов, с которым последние давно смирились, воспринимая его как неотъемлемую часть мироустройства, вдруг стало выглядеть чрезвычайно несправедливым – и даже безбожным. Это была взрывоопасная идея. С 1524 до 1525 г. около четверти миллиона крестьян Священной Римской империи приняли участие в Крестьянской войне, самом мощном народном восстании, подобного которому Европа не увидит вплоть до Французской революции (примерно через 250 лет). Война началась довольно невинно, с обычного спора между землевладельцами и фермерами-арендаторами о росте арендной платы и увеличении податей. Но на этот раз землевладельцы (в основном католические монастыри и церкви) занимали оборонительные позиции, а протестующие были полны сознания своей правоты. В результате десятки тысяч протестующих были убиты имперскими солдатами, еще тысячи подверглись пыткам. Параллельно более мелкие протесты происходили в других странах Западной Европы: восстание комунерос в Испании (1520–1521) против непосильного гнета налогов; Большой продовольственный бунт в Лионе (1529) из-за роста цен на пшеницу; восстание страччони (мотальщиков шелка) в Тоскане (1531–1532) после их изгнания из государственных учреждений; Благодатное паломничество (1536–1537) в Англии, вызванное религиозными реформами, ростом цен на продукты питания и новыми налогами. Подогретое Реформацией враждебное отношение к традиционной власти в сочетании с ростом безработицы, экономической нестабильностью и увеличением численности молодого населения привело к тому, что бунты и народные восстания по всей Европе вспыхивали от малейшей искры [38]. Само их количество увеличивало масштабы конфликтов и нанесенный ими ущерб и часто приводило к обострению протестов, начинавшихся довольно умеренно [39].

Таким образом, в XVI в. десятки тысяч человек погибли и сотни тысяч превратились в беженцев – население Европы раскололось на католиков и протестантов. Это была самая большая миграция населения в Европе до Первой мировой войны [40]. Колонны несчастных «тянулись по всем европейским дорогам», некоторых нужда толкала на преступления [41]. Когда в 1526 г. герцог Норфолкский остановил толпу английских крестьян и потребовал разговора с их предводителем, крестьяне находчиво ответили: «Вы спрашиваете, кто наш предводитель, – вот вам честный ответ: его имя Бедность, и это он, вместе со своим братом Нуждой, привел нас сюда» [42]. Беженцы несли с собой страхи и тревоги. Горожане, благодаря развитию медицины осведомленные о роли мигрантов в распространении болезней, инстинктивно старались избавиться от них или изолировать. Строились огромные богадельни, чтобы бродяги не попадались на глаза добропорядочным гражданам. По всей Западной Европе были приняты законы против мигрантов – чужим нищим приказывали покинуть город в строго обозначенный срок (обычно три дня) под страхом разнообразных наказаний: тюремное заключение, порка или каторжный труд на торговых кораблях. Но количество мигрантов росло слишком быстро, а чиновников было слишком мало, чтобы эти законы действительно выполнялись.

Социальные проблемы продолжали расти, а социальный порядок ослабевал, не в последнюю очередь потому, что договоренности, которые удерживали общество, не смогли адаптироваться к новым ожиданиям и к той силе, с которой они были высказаны.


Новый раскол

Изложенное выше кажется подозрительно знакомым. Тогда в народе росло ощущение, что высшие слои общества пренебрегают всеми остальными. Те, на кого была возложена обязанность заботиться о благополучии общества, были заняты не спасением народа, а собственным обогащением. Но их недобросовестность была разоблачена, и они утратили доверие народа. Общество раскололось. Всем пришлось заплатить ужасную цену, чтобы восстановить его целостность.

Сегодня мы оцениваем благополучие – и организации, созданные для его поддержки, – не столько в духовных, сколько в материальных терминах: доход, образование, продолжительность жизни, а также понятия, которые мы признаем как основные составляющие человеческого достоинства, – безопасность, возможность выбора и самовыражение. Но даже с учетом этих светских особенностей изложенные выше причины недовольства не случайно кажутся нам знакомыми. «Она обладает неутомимым стремлением к расширению своего могущества» [43]. Эти слова мог бы произнести Лютер, описывая папскую власть. Однако их произнес в 1999 г. выдающийся активист движения за свободную торговлю Ронни Холл о Всемирной торговой организации.

Это произошло во время «Битвы в Сиэтле», – около 3000 министров и представителей стран – членов ВТО (тогда их было 135) собрались в Сиэтле, чтобы начать новый «миллениум-раунд» переговоров по вопросам мировой торговли [44]. Их встретили от 40 до 100 тысяч недовольных, которые вышли на улицы и окружили место проведения конференции в знак протеста против организации, которая, несмотря на заявленное стремление поддерживать «открытую торговлю в общих интересах», была занята, по их мнению, продвижением интересов богатых за счет бедных и незащищенных групп населения. «Открытая торговля» стала для них эвфемизмом, который ВТО использовала для уничтожения демократических систем защиты рабочих, общества и окружающей среды, чтобы помочь инвесторам получать более высокие возвраты на вложенный капитал.

Протест был подавлен полицейскими, вооруженными перцовым спреем, слезоточивым газом, электрошоковыми гранатами и, наконец, резиновыми пулями. Но среди людей по-прежнему тлело недовольство. Встреча в Сиэтле не стала новым раундом переговоров по вопросам всемирной торговли. В общественный дискурс вошли понятия «антиглобализация» и «справедливая торговля». Все последующие глобальные встречи мировых правительств – встречи ВТО, Всемирного банка, МВФ, «Большой восьмерки», «Большой двадцатки», Всемирного экономического форума – сопровождались массовыми социальными протестами.

Потом лопнул пузырь доткомов и случилась террористическая атака 9/11: разговоры о глобализации стихли и толпы рассеялись. Гражданские свободы были ограничены, инакомыслие стало непатриотичным, особенно в Соединенных Штатах. Внимание народа обратилось в другую сторону: очевидная угроза транснациональных корпораций ослабла, и в качестве главных злодеев на омрачившейся международной сцене снова выступили военные. Тем временем в развитых странах возвраты на капитал росли, а заработная плата оставалась неизменной, – а значит, с каждым годом все больше и больше денег, заработанных в этих странах, переходило к богатым [45]. В результате с 2001 по 2007 г. общий объем частных капиталов в Северной Америке и Европе – общая стоимость домов, инвестиций и других активов, за вычетом долгов, – увеличился в два раза, с 75 триллионов долларов почти до 150 триллионов долларов [46], при этом ведущим 10 % богатых домохозяйств принадлежало 65–70 % этого имущества [47]. Для капиталистов развитых стран это были лучшие (в долларовом выражении) пять лет за всю историю. Наемные работники кое-как поддерживали свое существование.


99 новых тезисов об индульгенциях

Переломный момент для домохозяйств в развитых странах мира наступил, когда весь мир переживал последствия глобального финансового кризиса. Непосредственные последствия кризиса были достаточно тяжелыми (см. главу 6). Теперь, пережив рекордные потери права выкупа, безработицу и сокращение заработной платы и социальных пособий, общественность обнаружила, что богатые, чья инвестиционная деятельность и стала причиной кризиса, вовсе не испытывают схожих неудобств. Во всех странах ОЭСР с 2007 по 2011 г. доходы наименее обеспеченных 10 % наемных работников упали вдвое быстрее, чем доходы наиболее обеспеченных 10 % граждан. В США доходы 1 % самых обеспеченных граждан вообще не изменились. Более того, они даже остались с прибылью [48].

Общественный договор в США традиционно поддерживал терпимое отношение к разнице доходов – каждый американец имел право усердно работать и разбогатеть, – но это было уже чересчур. После окончания кризиса и до 2011 г. положение 99 % населения (чьи доходы уже упали на 12 %) еще ухудшилось, а доходы наиболее состоятельного 1 % восстановились почти полностью [49]. В результате их доля в накопленном богатстве нации, по сути, выросла так, что к 2011 г. 1 % граждан контролировал 37 % всех доходов американских домохозяйств. Это поколебало привычные многим американцам понятия о справедливости и честности. 1 % самых обеспеченных граждан не делали деньги, они переводили их из чужих карманов в свои собственные. Многим пришлось дорого заплатить за кризис: выплатой долгов из денег, которые могли бы быть потрачены на образование, транспорт или снижение налогов; своими рабочими местами (с 2008 по 2009 г. девять миллионов американцев лишились работы) [50]; и даже своими домами (с 2008 по 2013 г. банки обратили взыскание на 4,5 миллиона домов – трехсотпроцентный прирост по сравнению с предыдущей пятилеткой) [51]. Самые состоятельные получили прибыль.


Доля трудоустроенного трудоспособного населения США, 1990–2015 гг.

Эпоха открытий

Значительная доля работников в США потеряли работу (и до сих пор не нашли новую).

US Bureau of Labor Statistics (2015). “Labor Force Statistics from the Current Population Survey: Employment-Population Ratio.” United States Department of Labor. По материалам data.bls.gov


Разочаровавшись в «выходе из кризиса», которого на самом деле не произошло, в сентябре 2011 г. несколько сот человек собрались под лозунгом «Мы – 99 %» и в знак протеста оккупировали Зукотти-парк в Нью-Йорке, неподалеку от Уолл-стрит. Выступление, которое в другое время и в другом месте, возможно, осталось бы малозаметным актом гражданского неповиновения, неожиданно привлекло огромное количество сторонников среди недовольной мировой общественности. В течение месяца движение «Захвати» распространилось более чем в 950 городах в 82 странах на пяти континентах.


Протесты в демократическом мире

Движение «Захвати» стало мировым брендом, но оно само по себе было вдохновлено общественными протестами в Европе и арабском мире. В отличие от финансового кризиса в США, финансовый кризис, ударивший по некоторым европейским странам – Испании, Греции, Ирландии, Исландии и Италии, – намного превышал ресурсы правительств этих стран и лишал их возможности справиться с ситуацией. Они обратились за помощью в Европейский союз, Европейский центральный банк и Международный валютный фонд (известные под общим названием «The Troika»). «Тройка» предоставила им помощь – при условии, что они примут новые бюджеты и сократят государственные расходы на общественные нужды.

Эти «меры строгой экономии» совершенно не понравились населению, которое уже потеряло рабочие места и доходы в результате банковского кризиса. Те же люди, которые сначала смотрели сквозь пальцы на безрассудное кредитование, теперь требовали, чтобы правительства приватизировали государственные активы, сократили пенсии и зарплаты служащим госсектора, а также государственные расходы на общественные нужды, – чтобы международные кредиторы получили разумные гарантии того, что долг будет выплачен. В Греции начиная с 2010 г. сотни тысяч людей приняли участие в «Движении возмущенных граждан» – серии сидячих забастовок и общественных протестов [52]. Это были самые активные протесты в Греции со времен восстания против военной хунты в 1973 г. В Испании и Португалии, где безработица среди молодежи взлетела выше 40 %, тысячи участников движения «Indignados» («Возмущенные») в мае 2011 г. вышли на улицы, еще миллионы приходили в лагеря протестующих – волнения прокатились по всей стране [53]. В Италии в 2011 г. режим строгой экономии вызвал протест – в Риме против него выступило около 200 тысяч человек, а также новый кабинет неизбранных управленцев, целью которых было восстановить доверие международных кредиторов [54]. В конце 2013 г., после самого долгого в послевоенной истории Италии периода рецессии, на фоне безработицы среди молодежи, остановившейся на >40 %, возникло общенациональное Движение с вилами, к которому присоединились тысячи студентов, фермеров, рабочих и безработных, – оно показало, что правительству не удалось восстановить доверие народа. В марте 2011 г. в Лондоне произошел самый масштабный протест со времен начала войны в Ираке в 2003 г. – после того как правительство Великобритании запустило собственный план строгой экономии, чтобы выплатить возросший до 1,5 триллиона долларов долг для спасения британской банковской отрасли, на улицы вышло около полумиллиона человек [55]. Заявление о мерах экономии, которые к 2020 г. должны были снизить государственные расходы Великобритании, отныне исчисляемые как долю ВВП, до уровня 1930-х гг., совпало с появившимися в СМИ сообщениями о том, что миллиарды фунтов залоговых денег были использованы для выплаты банковских бонусов [56]. В июне 2015 г. более четверти миллиона британцев вышли на улицы Лондона в знак протеста против очередного раунда ужесточения режима строгой экономии [57].

Массовое разочарование стало предпосылкой серьезных политических сдвигов, как влево, так и вправо, по всей Европе. В 2012 г. президентом Франции был избран кандидат от Социалистической партии Франсуа Олланд, завоевавший сердца уставших от рецессии граждан обещанием обложить 75-процентным налогом все доходы выше 1 миллиона евро. (Сверхналог истек в 2014 г.) В то же время крайне правая партия Франции, Национальный фронт, одержала исторический успех на региональных выборах со своей анти-ЕС, антииммиграционной протекционистской программой. В 2015 г. Консервативная партия Великобритании снова получила большинство голосов британских избирателей после национальной кампании, в ходе которой приняла на себя обязательство провести публичный референдум по вопросу о выходе из Евросоюза. Через несколько месяцев потерпевшая поражение Лейбористская партия Великобритании избрала подавляющим большинством голосов наиболее левого лидера в своей истории [58]. В Испании политика строгой экономии вызвала появление партии «Podemos» («Мы можем») – возникнув в 2014 г., она очень быстро стала второй по численности партией в стране, а к концу года набрала больше лайков в Facebook, чем все остальные партии вместе взятые. В 2015 г. ее популярность стала угасать, отчасти из-за появления движения «Ciudadanos» («Граждане») – «правых подемос», которые привлекли к себе испанских избирателей обещанием искоренить коррупцию в правительстве [59]. В том же году греки проголосовали за включение в правительство Коалиции радикальных левых (СИРИЗА) и потребовали изменения условий выплаты долга иностранным кредиторам. Треть граждан Греции живет за чертой бедности, и они хотели помощи, а не суровой экономии. Таким образом, в 27 странах Европейского союза ни одно правительство, находившееся у власти в период финансового кризиса, не избежало поражения на следующих выборах – только Ангела Меркель все эти годы непрерывно сохраняет свои полномочия [60]. Избиратели отвергли те карты, которые им сдали, и перетасовали колоду.


Протесты в автократическом мире

В авторитарных и квазиавторитарных государствах политические механизмы перенаправления массового недовольства к новому общественному договору ослаблены, и протесты, как правило, заканчиваются либо репрессиями, либо революциями. Волна протестов, которая привела к свержению президента Туниса в январе 2011 г. (вызванная голодом, безработицей и повышением стоимости жизни), к декабрю 2013 г. докатилась до Египта, Ливии и Йемена, где правителей также заставили покинуть свои посты; вызвала массовые гражданские беспорядки в Бахрейне и Сирии; разожгла протесты в Кувейте, Ливане, Омане, Марокко, Иордании и других арабских странах. Движущие силы «арабской весны» не сводились к одной лишь экономической несправедливости, которая спровоцировала сидячие забастовки по всей Северной Америке и привела к краху правительства в Европе. Растущая разница в материальном положении граждан в арабских странах сыграла свою роль, но кроме нее существовали и другие факторы, о которых уже шла речь в этой книге: растущее молодое население, получившее более качественное образование и раздосадованное тем, насколько предложенный им общественный договор отличается от общественного договора, которым пользуются их сверстники в других странах мира; потрясения, в результате которых цены на продукты взлетели, а над мелкими общинами нависла угроза голода; вопиющая коррупция, кумовство и притеснения в общественных системах, которые по умолчанию ставили интересы сильного меньшинства выше интересов экономически безгласного большинства.

В Китае также происходят все более частые и интенсивные публичные протесты, хотя из всех авторитарных режимов современного мира Коммунистическая партия Китая обладает наиболее эффективным и сложным аппаратом для перевода в другое русло и рассеивания инакомыслия. Проект «Золотой щит», или «Великий китайский файрвол», препятствует организации гражданских акций; в середине 2015 г. в рамках полицейской программы было арестовано 15 тысяч человек за преступления, «ставящие под угрозу безопасность интернета» [61]. Когда люди действительно выходят на улицы, в этих местах быстро появляется полиция, подавляющая их одной только численностью, – так, в феврале 2011 г. китайские пользователи интернета, вдохновленные примером «арабской весны», призвали сторонников «жасминовой революции» собраться на популярной площади Пекина, – но, когда люди пришли на площадь, там уже дежурили сотни полицейских [62]. В то же время режим прилагает немало усилий, чтобы наделить своих граждан конкретными материальными благами (исторически беспрецедентный экономический рост, улучшение государственных услуг и программ социального обеспечения), и проявляет намерение ограничить собственную коррупцию. Режим умело пользуется методами мягкого воздействия, такими как образование и средства массовой информации, для формирования у общественности уверенности в том, что правительство «служит народу», одновременно посредством точечных жестких мер давая понять, что любая попытка бросить ему вызов потерпит неудачу. Хорошее правительство, вышедшее из народа и работающее для народа, – таков общественный договор, принятый в Китае. Пока он зарекомендовал себя как устойчивый и способный адаптироваться к потрясениям, которые привели к смещению руководства в других странах.

Цена нарушенного договора

Протест всегда был характерной чертой общественной жизни. Примечательными в протестах, бушевавших в предыдущем Ренессансе, были, во-первых, их сила, широта и частота, а во-вторых, та роль, которую в их возникновении сыграли новые технологии. Эти признаки, безусловно, наблюдаются и в Новом Ренессансе. В 2011 г. журнал Time назвал человеком года собирательный образ «Протестующего» в знак признания роли социальных движений, которые прокатились по всей планете от Нью-Йорка до Нью-Дели. Facebook, Twitter, WhatsApp и Snapchat стали для недовольных средством найти друг друга и объединить свои голоса.

Другой примечательной особенностью социального протеста эпохи предыдущего Ренессанса, от костра Савонаролы до Реформации Лютера, было изменение фокуса общественного негодования, которое переключилось с коррумпированных лидеров на коррумпированную систему в целом и привело к выводу, что для улучшения ситуации от системы необходимо отказаться. Так, в Сиэтле люди верили, что демократия поможет все исправить, и именно отсутствие демократического контроля в сфере торговых операций вызывало у них возмущение. Но к тому времени, как протестующие собрались в Зукотти-парке в Нью-Йорке, лозунг «Если бы голосование что-то меняло, оно уже давно бы это изменило» вышел в топ популярных хештегов. «Ошибка 404: Демократия не найдена» – под этим лозунгом выступало греческое Движение возмущенных граждан. Главный лозунг «арабской весны» был еще более прямолинейным: «Люди хотят свергнуть режим». Со временем традиционные политические игроки – разнообразные профсоюзы и оппозиционные партии – окончательно отошли в тень, поскольку население больше не доверяло им. Эти организации были связаны с теми же институтами, которые постыдным образом не справились со своей задачей представлять интересы населения и реагировать на его трудности.

Сегодня многие протестующие разошлись по домам, но вера в то, что традиционная политика может выполнять условия справедливого общественного договора во всем демократическом мире, уничтожена. Наследие движения «Захвати» и других оппозиционных движений – непоколебимое общественное разочарование – проявляется в том, что в последние годы на выборах побеждают крайне правые и крайне левые политики, которые обещают улучшить ситуацию, отменив все то, что сделали их умеренные предшественники. Оно проявляется в том, что избирателей теперь очаровывают когда-то считавшиеся неприличными резкие высказывания ведущих участников предвыборной гонки США, Великобритании, Франции и других крупных демократических стран, об иммигрантах, торговых партнерах и моральной слабости центристских политиков. Оно наглядно проявляется в новых конституционных кризисах, таких как шотландский референдум 2014 г. по вопросу о целесообразности разрыва трехсотлетнего союза с Великобританией. Понаблюдав за сменяющими друг друга правыми и левыми правительствами, многие шотландцы разуверились в политическом спектре Великобритании в целом и решили, что пришло время попрощаться. Сепаратисты проиграли, но с 45 % голосов они также и выиграли: в ходе развернувшихся после референдума конституционных переговоров Шотландия все равно забрала у британского правительства право принимать политические решения, касающиеся ее населения.

Тем временем картина неравенства в нашем обществе продолжает ухудшаться. Представьте себе: десять человек едят пирог. Один человек получает половину пирога. Пять человек делят между собой другую половину. Оставшиеся четыре человека собирают крошки (в этом случае 3 %). В 2015 г. таким в среднем было распределение доходов домохозяйств в 18 развитых странах, статистические данные по которым доступны [63]. (В США один человек получает четыре пятых пирога.) В развивающихся странах часто бывает трудно определить, кто и чем на самом деле владеет, но в целом разрыв между имущими и неимущими там еще больше.

Богатство – лишь один из аспектов общественного договора. Также сохраняется глубокое неравенство в вопросах здоровья, образования и возможностей, а во многих случаях оно даже ухудшилось. В США белые до сих пор живут в среднем на пять лет дольше, чем черные [64]. В Париже у людей, живущих к северо-востоку от Сены (реки, которая географически рассекает город на две части), шансов получить высшее образование в два раза меньше, чем у тех, кто живет на юго-востоке [65]. В Австралии взрослые граждане, зарабатывающие менее 20 тысяч долларов в год, в два раза чаще страдают от хронических заболеваний, болезней сердца, диабета или депрессии, чем те, кто зарабатывает более 50 тысяч долларов [66].

Чтобы обновить нашу веру, нам нужен новый общественный договор. Так считал Лютер. Так следует считать и нам. Для него этот новый общественный договор означал новое равенство перед Богом. Для нас он означает новое равенство друг с другом.


Новый диспут

Теперь, как и тогда, этот спорный вопрос решительно разделяет нас, и от исхода дискуссии зависит социальное единство.

Прежде всего это вопрос этики. Некоторые утверждают, что с нравственной точки зрения неравенство вполне справедливо, поскольку оно отражает разницу затраченных усилий, сообразительности и готовности идти на риск. Попытки критиковать богатых за то, что они пользуются выгодным случаем, когда другие этого не делают, больше говорят о зависти, чем о несправедливости.

Другие соглашаются, но тут же указывают на то, что бо́льшая часть этого богатства приобретена нетрудовым путем. При этом они критикуют не столько роль удачи, которая, хорошо это или плохо, имеет значение в жизнь каждого человека, сколько недостатки законодательных, экономических и правовых институтов, которые поощряют наследственную передачу богатства и влияния вместо личных усилий, а также указывают на то, что возможности обычно концентрируются в руках тех, кто уже богат.

Существует также нравственный вопрос об обязательствах богатых. Разумеется, в какой-то момент потребности тех, кто имеет меньше, перевешивают требования тех, кто уже обладает всем в избытке, – не так ли? Почти 900 миллионов человек в мире живут в нищете, 3,1 миллиона детей ежегодно умирают от голода [67]. Что это – просто несчастный случай или нравственное бездействие?

Кроме того, у неравенства есть экономический аспект.

С одной стороны, неравенство – всего лишь одно из последствий развития частной собственности и работы стимулов, из которых состоит капитализм. Капитализм является лучшей известной нам системой улучшения общего экономического благосостояния. История XX в. доказала, что альтернативы просто не существует. Если мы хотим пожинать преимущества динамичной, конкурентоспособной экономической системы, мы должны воспевать, а не демонизировать богатство, которое она создает, и спокойно принимать возникающие в результате различия. В 1990 г. акции трех крупнейших компаний Детройта стоили 36 миллиардов долларов, компании обеспечивали занятость 1,2 миллиона работников. В 2014 г. три крупнейшие фирмы Кремниевой долины стоили почти в 30 раз больше (более 1 триллиона долларов), но платили зарплату в девять раз меньшему количеству сотрудников (137 тысяч человек) [68]. Появление горстки миллиардеров и потеря миллиона рабочих мест – та цена, которую нам приходится платить за технологические достижения.

Или нет? Оппоненты быстро уточняют этот аргумент. После определенного момента преимущества, связанные с сохранением и увеличением богатства, теряют силу из-за неэффективности рынка, обусловленной экстремальным неравенством. Было доказано, что экстремальное неравенство угнетает экономический рост [69]. (Логика такова: когда богатые становятся богаче, они не покупают больше вещей, потому что у них уже все есть, – они просто делают больше накоплений. Но если бедные становятся богаче, они покупают все, чего им не хватало, – в том числе, и это самое главное, хорошее здоровье для себя и хорошее образование для своих детей.) Используя свои огромные богатства для того, чтобы влиять на политику, богатые вносят в экономику искажения, которые приносят пользу им и их фирмам, но подавляют инновации и замедляют широкий экономический прогресс.

Эта модель наиболее очевидно проявляет себя в авторитарных государствах. В Китае более трети всего богатства страны находится в руках 1 % граждан [70]. Коррумпированные чиновники, многие из которых сейчас в опале, накопили личные состояния за счет контроля над государственными активами и права раздавать лицензии и контракты без независимого надзора. Ангола, наделенная огромными природными ресурсами, существует, по сути, при клептократии – лидеры страны, по выражению журнала The Economist, «живут в африканской версии Сен-Тропе», в то время как в столице государства Луанде у 90 % жителей нет водопровода [71]. Все это примеры явления, которое экономисты называют «погоней за рентой», – стремления делать деньги, отбирая богатство у других членов общества, а не создавая его заново.

Но и в демократических институтах, захваченных влиятельной элитой, может процветать коррупция, – элита заставляет их обслуживать свои интересы, нанося тем самым ущерб широкой экономике. В США 1 % наиболее состоятельных граждан принадлежит более трети всех доходов [72]. Законодательные органы имеют огромные полномочия для передвижения богатства вверх или вниз по социальной лестнице: путем расширения или сокращения программ социального обеспечения; распределения налогового бремени между богатыми и бедными, инвесторами и наемными работниками, а также между корпорациями и частными лицами; путем ценообразования и продажи государственных активов и общественных благ, таких как железные дороги, почта, объекты нефтяного промысла и беспроводной спектр; путем